Mutagenetix > Incidental Mutations

Incidental Mutation 'R2094:Gm8251'

231953

Institutional Source

Beutler Lab

Gene Symbol

Gm8251

Ensembl Gene

ENSMUSG00000091844

Gene Name

predicted gene 8251

Synonyms

MMRRC Submission

040098-MU

Accession Numbers

Genbank: XM_985572; MGI: 3647616

Is this an essential gene?

Probably non essential (E-score: 0.108) question?

Stock #

R2094 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

44055952-44061936 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 44059730 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Serine at position 736 (I736S)

Ref Sequence

ENSEMBL: ENSMUSP00000127017 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168641]

Predicted Effect

probably benign
Transcript: ENSMUST00000168641
AA Change: I736S

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000127017
Gene: ENSMUSG00000091844
AA Change: I736S

Domain	Start	End	E-Value	Type
Pfam:CCDC168_N	2	202	2.5e-83	PFAM
Pfam:CCDC168_N	200	302	1.7e-26	PFAM
Pfam:CCDC168_N	347	397	2.1e-4	PFAM
Pfam:CCDC168_N	437	581	8.5e-8	PFAM
Pfam:CCDC168_N	663	802	6.3e-5	PFAM
Pfam:CCDC168_N	788	955	1e-9	PFAM
low complexity region	1803	1819	N/A	INTRINSIC
low complexity region	1830	1847	N/A	INTRINSIC
low complexity region	1968	1984	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

100% (56/56)

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A130010J15Rik	A	G	1: 193,174,846	I169V	probably benign	Het
Arrdc5	A	G	17: 56,297,856	S144P	probably benign	Het
Astn1	A	G	1: 158,667,609	M92V	probably benign	Het
Atg5	A	G	10: 44,319,548	I189M	probably damaging	Het
Atmin	A	G	8: 116,957,538	T646A	probably damaging	Het
Atp1a2	G	A	1: 172,287,433	R262W	probably damaging	Het
Atp6v1g2	A	G	17: 35,236,809	K16E	probably damaging	Het
Bex6	G	A	16: 32,186,460	E29K	possibly damaging	Het
Casd1	A	G	6: 4,608,705	Y101C	probably damaging	Het
Cdx1	T	C	18: 61,035,912	D70G	possibly damaging	Het
Cebpz	T	C	17: 78,935,554	T224A	probably benign	Het
Cep170b	T	C	12: 112,735,730	V319A	possibly damaging	Het
Chrna2	C	T	14: 66,149,463	R353W	possibly damaging	Het
Chst5	A	T	8: 111,890,544	V148E	probably benign	Het
Clhc1	T	A	11: 29,557,771	W162R	probably benign	Het
Csmd1	T	A	8: 16,079,978	Q1710L	probably damaging	Het
Ddb1	A	C	19: 10,612,936	M276L	probably benign	Het
Dot1l	C	T	10: 80,785,878	R455C	probably damaging	Het
Dync2h1	A	G	9: 7,148,735	V903A	probably benign	Het
Eno1b	T	C	18: 48,047,475	V240A	possibly damaging	Het
Erich1	T	G	8: 14,090,527		probably benign	Het
Ermp1	A	C	19: 29,639,928	S227A	probably benign	Het
Etv1	C	A	12: 38,835,116	P143Q	probably null	Het
Gimap8	A	T	6: 48,650,568	I159F	probably benign	Het
Gm12666	A	G	4: 92,191,656	S32P	probably damaging	Het
Gpr4	G	A	7: 19,222,578	V142M	possibly damaging	Het
Gucy1a1	C	T	3: 82,113,332	C86Y	probably benign	Het
Ifngr2	T	G	16: 91,561,779		probably null	Het
Insrr	A	T	3: 87,803,181	N398I	probably damaging	Het
Iws1	A	G	18: 32,084,666	E441G	probably damaging	Het
Megf10	A	T	18: 57,281,713	K732*	probably null	Het
Mprip	T	A	11: 59,749,508		probably benign	Het
Mrgprb8	T	C	7: 48,389,205	V208A	probably benign	Het
Msc	G	C	1: 14,755,684	P22R	probably benign	Het
Olfr725	A	T	14: 50,034,714	S230T	probably damaging	Het
Opcml	G	A	9: 28,901,590	E193K	probably damaging	Het
Oxsr1	A	C	9: 119,294,494	H71Q	probably benign	Het
Pkp2	T	A	16: 16,246,967	W452R	probably damaging	Het
Prrc2b	C	T	2: 32,182,570	T20I	probably damaging	Het
Rasgrp3	T	C	17: 75,503,141	S279P	probably damaging	Het
Rtl1	T	A	12: 109,591,397	D1336V	unknown	Het
Serpina3m	G	T	12: 104,389,270	K65N	probably benign	Het
Serpine2	A	G	1: 79,810,694	V182A	probably damaging	Het
Slc10a1	A	G	12: 80,956,048	V272A	possibly damaging	Het
Slc25a29	A	T	12: 108,827,432	N73K	probably damaging	Het
Slit1	G	A	19: 41,606,380	R1184W	probably damaging	Het
Srrm2	T	C	17: 23,812,429		probably benign	Het
Stk11ip	A	G	1: 75,525,521		probably benign	Het
Tcerg1	A	G	18: 42,564,145	K767R	possibly damaging	Het
Tmem82	T	C	4: 141,616,287	K224R	probably benign	Het
Tmprss11g	A	G	5: 86,499,556	L41S	probably damaging	Het
Trim42	T	C	9: 97,366,097	N182S	probably benign	Het
Ttn	T	C	2: 76,830,088	T7430A	probably benign	Het
Wwp1	T	C	4: 19,650,390	T259A	probably benign	Het

Other mutations in Gm8251

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
D3080:Gm8251	UTSW	1	44067335
R0045:Gm8251	UTSW	1	44057205	missense	probably benign
R0110:Gm8251	UTSW	1	44059224	missense	probably benign
R0450:Gm8251	UTSW	1	44061097	missense	possibly damaging	0.85
R0469:Gm8251	UTSW	1	44061097	missense	possibly damaging	0.85
R0510:Gm8251	UTSW	1	44061097	missense	possibly damaging	0.85
R0602:Gm8251	UTSW	1	44059967	missense	possibly damaging	0.96
R0648:Gm8251	UTSW	1	44056563	missense	possibly damaging	0.73
R0928:Gm8251	UTSW	1	44057228	missense	possibly damaging	0.73
R1056:Gm8251	UTSW	1	44060927	missense	probably damaging	1.00
R1217:Gm8251	UTSW	1	44057179	missense	possibly damaging	0.73
R1232:Gm8251	UTSW	1	44056592	missense	possibly damaging	0.96
R1399:Gm8251	UTSW	1	44061311	missense	possibly damaging	0.93
R1489:Gm8251	UTSW	1	44057790	missense	probably benign	0.18
R1489:Gm8251	UTSW	1	44061507	missense	probably benign	0.06
R1519:Gm8251	UTSW	1	44056970	missense	probably benign	0.33
R1664:Gm8251	UTSW	1	44059227	missense	possibly damaging	0.71
R1828:Gm8251	UTSW	1	44057074	missense	possibly damaging	0.72
R1944:Gm8251	UTSW	1	44061849	missense	probably damaging	0.97
R2032:Gm8251	UTSW	1	44061740	missense	possibly damaging	0.86
R2170:Gm8251	UTSW	1	44056008	missense	probably benign	0.18
R2185:Gm8251	UTSW	1	44061381	missense	probably benign	0.01
R2280:Gm8251	UTSW	1	44056460	missense	possibly damaging	0.53
R2281:Gm8251	UTSW	1	44056460	missense	possibly damaging	0.53
R2339:Gm8251	UTSW	1	44060863	missense	probably benign
R3617:Gm8251	UTSW	1	44060954	missense	probably benign
R3738:Gm8251	UTSW	1	44058866	missense	probably benign	0.33
R4012:Gm8251	UTSW	1	44060969	missense	possibly damaging	0.85
R4034:Gm8251	UTSW	1	44058866	missense	probably benign	0.33
R4344:Gm8251	UTSW	1	44060991	missense	possibly damaging	0.86
R4436:Gm8251	UTSW	1	44056116	missense	probably benign	0.03
R4485:Gm8251	UTSW	1	44060123	missense	probably benign
R4735:Gm8251	UTSW	1	44061701	missense	probably benign
R4782:Gm8251	UTSW	1	44059043	missense	possibly damaging	0.85
R4837:Gm8251	UTSW	1	44061434	missense	possibly damaging	0.93
R4862:Gm8251	UTSW	1	44058018	missense	possibly damaging	0.93
R5247:Gm8251	UTSW	1	44057006	nonsense	probably null
R5347:Gm8251	UTSW	1	44057795	missense	probably benign	0.01
R5355:Gm8251	UTSW	1	44057979	missense	possibly damaging	0.53
R5559:Gm8251	UTSW	1	44058515	missense	possibly damaging	0.77
R5640:Gm8251	UTSW	1	44061927	missense	probably benign	0.00
R5681:Gm8251	UTSW	1	44061464	missense	possibly damaging	0.93
R5776:Gm8251	UTSW	1	44056505	missense	possibly damaging	0.72
R5919:Gm8251	UTSW	1	44056986	missense	probably benign
R5987:Gm8251	UTSW	1	44057257	missense	probably benign
R6616:Gm8251	UTSW	1	44061474	missense	possibly damaging	0.51
R6677:Gm8251	UTSW	1	44058699	missense	probably benign	0.00
R6830:Gm8251	UTSW	1	44056730	missense	probably benign	0.33
R6906:Gm8251	UTSW	1	44056013	missense	probably benign	0.33
R6909:Gm8251	UTSW	1	44059775	missense	possibly damaging	0.71
R6957:Gm8251	UTSW	1	44057207	missense	probably benign	0.00
R7008:Gm8251	UTSW	1	44059625	missense	probably benign
R7052:Gm8251	UTSW	1	44057306	missense	possibly damaging	0.53
R7176:Gm8251	UTSW	1	44060346	missense	probably benign	0.00
R7190:Gm8251	UTSW	1	44061615	missense	probably benign	0.32
R7296:Gm8251	UTSW	1	44060916	nonsense	probably null
R7347:Gm8251	UTSW	1	44059496	missense	probably damaging	0.99
R7371:Gm8251	UTSW	1	44061377	missense	probably benign
R7375:Gm8251	UTSW	1	44060534	missense	possibly damaging	0.53
R7442:Gm8251	UTSW	1	44058708	missense	possibly damaging	0.84
R7450:Gm8251	UTSW	1	44058773	missense	probably benign	0.33
R7574:Gm8251	UTSW	1	44059433	missense	possibly damaging	0.93
R7586:Gm8251	UTSW	1	44060013	missense	probably benign	0.20
R7739:Gm8251	UTSW	1	44056418	missense	possibly damaging	0.86
R7878:Gm8251	UTSW	1	44056014	missense	probably benign	0.18
R7959:Gm8251	UTSW	1	44057568	missense	probably benign
R7991:Gm8251	UTSW	1	44059709	missense	probably benign	0.00
R8035:Gm8251	UTSW	1	44061551	missense	possibly damaging	0.51
R8281:Gm8251	UTSW	1	44056538	missense	possibly damaging	0.93
R8523:Gm8251	UTSW	1	44060834	missense	possibly damaging	0.86
YA93:Gm8251	UTSW	1	44065085	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- TGAAATTGGTGAGACCTTTGCC -3'
(R):5'- CAGGAGAGGCACAGATATAACTTTG -3'

Sequencing Primer
(F):5'- AGGCATCTCAACTGTCAAGTCTACTG -3'
(R):5'- GGCACAGATATAACTTTGAAATCACG -3'

Posted On

2014-09-18