Incidental Mutation 'R2094:Serpine2'
ID231955
Institutional Source Beutler Lab
Gene Symbol Serpine2
Ensembl Gene ENSMUSG00000026249
Gene Nameserine (or cysteine) peptidase inhibitor, clade E, member 2
Synonymsprotease nexin 1, Spi4, B230326M24Rik, nexin, PN-1, PI7
MMRRC Submission 040098-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2094 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location79794197-79861180 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79810694 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 182 (V182A)
Ref Sequence ENSEMBL: ENSMUSP00000140255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027467] [ENSMUST00000189793] [ENSMUST00000190724]
Predicted Effect probably damaging
Transcript: ENSMUST00000027467
AA Change: V182A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027467
Gene: ENSMUSG00000026249
AA Change: V182A

DomainStartEndE-ValueType
SERPIN 36 397 9.93e-152 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153862
Predicted Effect probably damaging
Transcript: ENSMUST00000189793
AA Change: V35A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140065
Gene: ENSMUSG00000026249
AA Change: V35A

DomainStartEndE-ValueType
SERPIN 1 231 2.3e-39 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190724
AA Change: V182A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140255
Gene: ENSMUSG00000026249
AA Change: V182A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SERPIN 36 232 7.1e-12 SMART
Meta Mutation Damage Score 0.8045 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serpin family of proteins, a group of proteins that inhibit serine proteases. Thrombin, urokinase, plasmin and trypsin are among the proteases that this family member can inhibit. This gene is a susceptibility gene for chronic obstructive pulmonary disease and for emphysema. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a targeted mutation of this gene are viable and healthy but develop epileptic activity as well as reduced theta burst-induced LTP and NMDA receptor-mediated synaptic transmission in the CA1 field of the hippocampus; notably, homozygous mutant males are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A G 1: 193,174,846 I169V probably benign Het
Arrdc5 A G 17: 56,297,856 S144P probably benign Het
Astn1 A G 1: 158,667,609 M92V probably benign Het
Atg5 A G 10: 44,319,548 I189M probably damaging Het
Atmin A G 8: 116,957,538 T646A probably damaging Het
Atp1a2 G A 1: 172,287,433 R262W probably damaging Het
Atp6v1g2 A G 17: 35,236,809 K16E probably damaging Het
Bex6 G A 16: 32,186,460 E29K possibly damaging Het
Casd1 A G 6: 4,608,705 Y101C probably damaging Het
Cdx1 T C 18: 61,035,912 D70G possibly damaging Het
Cebpz T C 17: 78,935,554 T224A probably benign Het
Cep170b T C 12: 112,735,730 V319A possibly damaging Het
Chrna2 C T 14: 66,149,463 R353W possibly damaging Het
Chst5 A T 8: 111,890,544 V148E probably benign Het
Clhc1 T A 11: 29,557,771 W162R probably benign Het
Csmd1 T A 8: 16,079,978 Q1710L probably damaging Het
Ddb1 A C 19: 10,612,936 M276L probably benign Het
Dot1l C T 10: 80,785,878 R455C probably damaging Het
Dync2h1 A G 9: 7,148,735 V903A probably benign Het
Eno1b T C 18: 48,047,475 V240A possibly damaging Het
Erich1 T G 8: 14,090,527 probably benign Het
Ermp1 A C 19: 29,639,928 S227A probably benign Het
Etv1 C A 12: 38,835,116 P143Q probably null Het
Gimap8 A T 6: 48,650,568 I159F probably benign Het
Gm12666 A G 4: 92,191,656 S32P probably damaging Het
Gm8251 A C 1: 44,059,730 I736S probably benign Het
Gpr4 G A 7: 19,222,578 V142M possibly damaging Het
Gucy1a1 C T 3: 82,113,332 C86Y probably benign Het
Ifngr2 T G 16: 91,561,779 probably null Het
Insrr A T 3: 87,803,181 N398I probably damaging Het
Iws1 A G 18: 32,084,666 E441G probably damaging Het
Megf10 A T 18: 57,281,713 K732* probably null Het
Mprip T A 11: 59,749,508 probably benign Het
Mrgprb8 T C 7: 48,389,205 V208A probably benign Het
Msc G C 1: 14,755,684 P22R probably benign Het
Olfr725 A T 14: 50,034,714 S230T probably damaging Het
Opcml G A 9: 28,901,590 E193K probably damaging Het
Oxsr1 A C 9: 119,294,494 H71Q probably benign Het
Pkp2 T A 16: 16,246,967 W452R probably damaging Het
Prrc2b C T 2: 32,182,570 T20I probably damaging Het
Rasgrp3 T C 17: 75,503,141 S279P probably damaging Het
Rtl1 T A 12: 109,591,397 D1336V unknown Het
Serpina3m G T 12: 104,389,270 K65N probably benign Het
Slc10a1 A G 12: 80,956,048 V272A possibly damaging Het
Slc25a29 A T 12: 108,827,432 N73K probably damaging Het
Slit1 G A 19: 41,606,380 R1184W probably damaging Het
Srrm2 T C 17: 23,812,429 probably benign Het
Stk11ip A G 1: 75,525,521 probably benign Het
Tcerg1 A G 18: 42,564,145 K767R possibly damaging Het
Tmem82 T C 4: 141,616,287 K224R probably benign Het
Tmprss11g A G 5: 86,499,556 L41S probably damaging Het
Trim42 T C 9: 97,366,097 N182S probably benign Het
Ttn T C 2: 76,830,088 T7430A probably benign Het
Wwp1 T C 4: 19,650,390 T259A probably benign Het
Other mutations in Serpine2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Serpine2 APN 1 79810694 missense probably damaging 0.98
IGL01386:Serpine2 APN 1 79801551 missense probably damaging 0.97
IGL02069:Serpine2 APN 1 79821412 missense possibly damaging 0.94
IGL02516:Serpine2 APN 1 79794997 unclassified probably benign
IGL02743:Serpine2 APN 1 79801555 missense probably damaging 1.00
R0372:Serpine2 UTSW 1 79821430 missense probably damaging 0.98
R1519:Serpine2 UTSW 1 79795031 missense probably damaging 1.00
R1768:Serpine2 UTSW 1 79816815 missense probably damaging 1.00
R1993:Serpine2 UTSW 1 79821442 missense probably damaging 1.00
R1995:Serpine2 UTSW 1 79821442 missense probably damaging 1.00
R2034:Serpine2 UTSW 1 79796852 missense probably damaging 1.00
R2311:Serpine2 UTSW 1 79810548 splice site probably benign
R2312:Serpine2 UTSW 1 79802853 missense probably damaging 1.00
R2519:Serpine2 UTSW 1 79799539 missense possibly damaging 0.55
R4844:Serpine2 UTSW 1 79799524 nonsense probably null
R5141:Serpine2 UTSW 1 79802863 missense possibly damaging 0.92
R5386:Serpine2 UTSW 1 79821287 nonsense probably null
R5422:Serpine2 UTSW 1 79816875 missense probably benign 0.03
R5422:Serpine2 UTSW 1 79821489 missense probably benign 0.10
R5786:Serpine2 UTSW 1 79816920 missense probably benign 0.02
R5794:Serpine2 UTSW 1 79821439 missense probably benign
R6109:Serpine2 UTSW 1 79810671 missense probably damaging 1.00
R6514:Serpine2 UTSW 1 79821570 splice site probably null
R6544:Serpine2 UTSW 1 79803130 intron probably null
R7001:Serpine2 UTSW 1 79795031 missense probably damaging 1.00
R7395:Serpine2 UTSW 1 79801555 missense probably damaging 1.00
R7660:Serpine2 UTSW 1 79802905 missense probably benign 0.07
R7844:Serpine2 UTSW 1 79816799 missense probably benign
R7927:Serpine2 UTSW 1 79816799 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCCTTCCTGCTACTAGTACATTAG -3'
(R):5'- AGTGTGCTTTAGAAATCCAGTTGAG -3'

Sequencing Primer
(F):5'- CTAGTACATTAGAATAGACCTCACCC -3'
(R):5'- CTCAGCTACATAGAGTTTGAGGCC -3'
Posted On2014-09-18