Mutagenetix > Incidental Mutation

Incidental Mutation 'R2094:Astn1'

231956

Institutional Source

Beutler Lab

Gene Symbol

Astn1

Ensembl Gene

ENSMUSG00000026587

Gene Name

astrotactin 1

Synonyms

MMRRC Submission

040098-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.089) question?

Stock #

R2094 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

158189843-158519351 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 158495179 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 92 (M92V)

Ref Sequence

ENSEMBL: ENSMUSP00000141260 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046110] [ENSMUST00000192821] [ENSMUST00000193042] [ENSMUST00000195311]

AlphaFold

Q61137

Predicted Effect

probably benign
Transcript: ENSMUST00000046110
AA Change: M1068V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000039711
Gene: ENSMUSG00000026587
AA Change: M1068V

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	507	1.2e1	SMART
EGF	611	652	2.29e1	SMART
EGF_like	659	708	3.57e1	SMART
MACPF	811	999	1.11e-56	SMART
FN3	1030	1142	5.75e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000192821
AA Change: M92V

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000141260
Gene: ENSMUSG00000026587
AA Change: M92V

Domain	Start	End	E-Value	Type
FN3	46	158	2.8e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000193042
AA Change: M1076V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000142322
Gene: ENSMUSG00000026587
AA Change: M1076V

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	507	1.2e1	SMART
EGF	611	652	2.29e1	SMART
EGF_like	659	708	3.57e1	SMART
MACPF	811	999	1.11e-56	SMART
FN3	1030	1142	5.75e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000194217

Predicted Effect

probably benign
Transcript: ENSMUST00000195311
AA Change: M1068V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000141518
Gene: ENSMUSG00000026587
AA Change: M1068V

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	499	2e-2	SMART
EGF	603	644	1.1e-1	SMART
EGF_like	651	700	1.7e-1	SMART
MACPF	803	991	6.2e-59	SMART
FN3	1022	1134	2.8e-4	SMART

Meta Mutation Damage Score

0.0852

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Astrotactin is a neuronal adhesion molecule required for glial-guided migration of young postmitotic neuroblasts in cortical regions of developing brain, including cerebrum, hippocampus, cerebellum, and olfactory bulb (Fink et al., 1995).[supplied by OMIM, Jun 2009]
PHENOTYPE: Homozygous mutation of this gene results in reduced cerebellum size, abnormal Purkinje cell morphology, and reduced coordination performance on the Rotarod test. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A130010J15Rik	A	G	1: 192,857,154 (GRCm39)	I169V	probably benign	Het
Arrdc5	A	G	17: 56,604,856 (GRCm39)	S144P	probably benign	Het
Atg5	A	G	10: 44,195,544 (GRCm39)	I189M	probably damaging	Het
Atmin	A	G	8: 117,684,277 (GRCm39)	T646A	probably damaging	Het
Atp1a2	G	A	1: 172,115,000 (GRCm39)	R262W	probably damaging	Het
Atp6v1g2	A	G	17: 35,455,785 (GRCm39)	K16E	probably damaging	Het
Bex6	G	A	16: 32,005,278 (GRCm39)	E29K	possibly damaging	Het
Casd1	A	G	6: 4,608,705 (GRCm39)	Y101C	probably damaging	Het
Ccdc168	A	C	1: 44,098,890 (GRCm39)	I736S	probably benign	Het
Cdx1	T	C	18: 61,168,984 (GRCm39)	D70G	possibly damaging	Het
Cebpz	T	C	17: 79,242,983 (GRCm39)	T224A	probably benign	Het
Cep170b	T	C	12: 112,702,164 (GRCm39)	V319A	possibly damaging	Het
Chrna2	C	T	14: 66,386,912 (GRCm39)	R353W	possibly damaging	Het
Chst5	A	T	8: 112,617,176 (GRCm39)	V148E	probably benign	Het
Clhc1	T	A	11: 29,507,771 (GRCm39)	W162R	probably benign	Het
Csmd1	T	A	8: 16,129,992 (GRCm39)	Q1710L	probably damaging	Het
Ddb1	A	C	19: 10,590,300 (GRCm39)	M276L	probably benign	Het
Dot1l	C	T	10: 80,621,712 (GRCm39)	R455C	probably damaging	Het
Dync2h1	A	G	9: 7,148,735 (GRCm39)	V903A	probably benign	Het
Eno1b	T	C	18: 48,180,542 (GRCm39)	V240A	possibly damaging	Het
Erich1	T	G	8: 14,140,527 (GRCm39)		probably benign	Het
Ermp1	A	C	19: 29,617,328 (GRCm39)	S227A	probably benign	Het
Etv1	C	A	12: 38,885,115 (GRCm39)	P143Q	probably null	Het
Gimap8	A	T	6: 48,627,502 (GRCm39)	I159F	probably benign	Het
Gpr4	G	A	7: 18,956,503 (GRCm39)	V142M	possibly damaging	Het
Gucy1a1	C	T	3: 82,020,639 (GRCm39)	C86Y	probably benign	Het
Ifngr2	T	G	16: 91,358,667 (GRCm39)		probably null	Het
Insrr	A	T	3: 87,710,488 (GRCm39)	N398I	probably damaging	Het
Iws1	A	G	18: 32,217,719 (GRCm39)	E441G	probably damaging	Het
Larp7-ps	A	G	4: 92,079,893 (GRCm39)	S32P	probably damaging	Het
Megf10	A	T	18: 57,414,785 (GRCm39)	K732*	probably null	Het
Mprip	T	A	11: 59,640,334 (GRCm39)		probably benign	Het
Mrgprb8	T	C	7: 48,038,953 (GRCm39)	V208A	probably benign	Het
Msc	G	C	1: 14,825,908 (GRCm39)	P22R	probably benign	Het
Opcml	G	A	9: 28,812,886 (GRCm39)	E193K	probably damaging	Het
Or4k15b	A	T	14: 50,272,171 (GRCm39)	S230T	probably damaging	Het
Oxsr1	A	C	9: 119,123,560 (GRCm39)	H71Q	probably benign	Het
Pkp2	T	A	16: 16,064,831 (GRCm39)	W452R	probably damaging	Het
Prrc2b	C	T	2: 32,072,582 (GRCm39)	T20I	probably damaging	Het
Rasgrp3	T	C	17: 75,810,136 (GRCm39)	S279P	probably damaging	Het
Rtl1	T	A	12: 109,557,831 (GRCm39)	D1336V	unknown	Het
Serpina3m	G	T	12: 104,355,529 (GRCm39)	K65N	probably benign	Het
Serpine2	A	G	1: 79,788,411 (GRCm39)	V182A	probably damaging	Het
Slc10a1	A	G	12: 81,002,822 (GRCm39)	V272A	possibly damaging	Het
Slc25a29	A	T	12: 108,793,358 (GRCm39)	N73K	probably damaging	Het
Slit1	G	A	19: 41,594,819 (GRCm39)	R1184W	probably damaging	Het
Srrm2	T	C	17: 24,031,403 (GRCm39)		probably benign	Het
Stk11ip	A	G	1: 75,502,165 (GRCm39)		probably benign	Het
Tcerg1	A	G	18: 42,697,210 (GRCm39)	K767R	possibly damaging	Het
Tmem82	T	C	4: 141,343,598 (GRCm39)	K224R	probably benign	Het
Tmprss11g	A	G	5: 86,647,415 (GRCm39)	L41S	probably damaging	Het
Trim42	T	C	9: 97,248,150 (GRCm39)	N182S	probably benign	Het
Ttn	T	C	2: 76,660,432 (GRCm39)	T7430A	probably benign	Het
Wwp1	T	C	4: 19,650,390 (GRCm39)	T259A	probably benign	Het

Other mutations in Astn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:Astn1	APN	1	158,427,889 (GRCm39)	missense	possibly damaging	0.71
IGL01705:Astn1	APN	1	158,331,883 (GRCm39)	missense	probably damaging	1.00
IGL01790:Astn1	APN	1	158,407,897 (GRCm39)	missense	possibly damaging	0.70
IGL01962:Astn1	APN	1	158,496,201 (GRCm39)	missense	probably damaging	1.00
IGL02000:Astn1	APN	1	158,502,184 (GRCm39)	missense	probably damaging	1.00
IGL02119:Astn1	APN	1	158,338,724 (GRCm39)	intron	probably benign
IGL02168:Astn1	APN	1	158,436,911 (GRCm39)	missense	possibly damaging	0.93
IGL02239:Astn1	APN	1	158,491,700 (GRCm39)	critical splice donor site	probably null
IGL02271:Astn1	APN	1	158,338,520 (GRCm39)	splice site	probably benign
IGL02307:Astn1	APN	1	158,502,184 (GRCm39)	missense	probably damaging	1.00
IGL02504:Astn1	APN	1	158,329,978 (GRCm39)	missense	probably damaging	1.00
IGL02552:Astn1	APN	1	158,332,965 (GRCm39)	missense	possibly damaging	0.90
IGL02903:Astn1	APN	1	158,516,120 (GRCm39)	missense	probably damaging	0.99
IGL03003:Astn1	APN	1	158,439,965 (GRCm39)	missense	probably benign	0.00
IGL03007:Astn1	APN	1	158,496,193 (GRCm39)	splice site	probably benign
IGL03354:Astn1	APN	1	158,516,174 (GRCm39)	missense	probably damaging	1.00
PIT4366001:Astn1	UTSW	1	158,424,781 (GRCm39)	missense	probably benign	0.23
PIT4366001:Astn1	UTSW	1	158,424,779 (GRCm39)	missense	probably benign	0.20
R0024:Astn1	UTSW	1	158,511,785 (GRCm39)	missense	probably damaging	0.99
R0050:Astn1	UTSW	1	158,407,294 (GRCm39)	splice site	probably benign
R0099:Astn1	UTSW	1	158,329,721 (GRCm39)	missense	probably damaging	1.00
R0109:Astn1	UTSW	1	158,491,674 (GRCm39)	missense	possibly damaging	0.79
R0109:Astn1	UTSW	1	158,491,674 (GRCm39)	missense	possibly damaging	0.79
R0365:Astn1	UTSW	1	158,516,118 (GRCm39)	missense	probably damaging	1.00
R0416:Astn1	UTSW	1	158,337,461 (GRCm39)	missense	probably damaging	1.00
R0531:Astn1	UTSW	1	158,427,959 (GRCm39)	missense	probably damaging	0.99
R0735:Astn1	UTSW	1	158,299,959 (GRCm39)	missense	possibly damaging	0.53
R0763:Astn1	UTSW	1	158,337,460 (GRCm39)	missense	possibly damaging	0.93
R0899:Astn1	UTSW	1	158,338,679 (GRCm39)	nonsense	probably null
R1027:Astn1	UTSW	1	158,407,849 (GRCm39)	missense	probably damaging	1.00
R1160:Astn1	UTSW	1	158,427,935 (GRCm39)	missense	possibly damaging	0.83
R1474:Astn1	UTSW	1	158,329,923 (GRCm39)	missense	probably damaging	1.00
R1517:Astn1	UTSW	1	158,407,146 (GRCm39)	splice site	probably benign
R1701:Astn1	UTSW	1	158,331,877 (GRCm39)	missense	possibly damaging	0.54
R1764:Astn1	UTSW	1	158,331,821 (GRCm39)	missense	probably benign	0.35
R1860:Astn1	UTSW	1	158,429,515 (GRCm39)	missense	probably damaging	1.00
R1889:Astn1	UTSW	1	158,332,886 (GRCm39)	splice site	probably null
R1919:Astn1	UTSW	1	158,337,541 (GRCm39)	missense	probably damaging	1.00
R2001:Astn1	UTSW	1	158,348,091 (GRCm39)	missense	probably damaging	1.00
R2007:Astn1	UTSW	1	158,436,875 (GRCm39)	missense	probably damaging	0.97
R2038:Astn1	UTSW	1	158,484,690 (GRCm39)	missense	probably benign	0.29
R2044:Astn1	UTSW	1	158,428,072 (GRCm39)	missense	possibly damaging	0.53
R2084:Astn1	UTSW	1	158,299,978 (GRCm39)	missense	probably damaging	0.99
R2163:Astn1	UTSW	1	158,329,720 (GRCm39)	missense	probably damaging	0.99
R2211:Astn1	UTSW	1	158,484,876 (GRCm39)	missense	probably benign	0.40
R2268:Astn1	UTSW	1	158,329,669 (GRCm39)	missense	probably damaging	1.00
R2269:Astn1	UTSW	1	158,329,669 (GRCm39)	missense	probably damaging	1.00
R2425:Astn1	UTSW	1	158,407,236 (GRCm39)	missense	probably damaging	0.99
R2428:Astn1	UTSW	1	158,439,916 (GRCm39)	missense	possibly damaging	0.66
R2980:Astn1	UTSW	1	158,400,521 (GRCm39)	critical splice acceptor site	probably null
R3713:Astn1	UTSW	1	158,495,102 (GRCm39)	missense	possibly damaging	0.83
R3745:Astn1	UTSW	1	158,329,630 (GRCm39)	missense	probably damaging	1.00
R3926:Astn1	UTSW	1	158,407,227 (GRCm39)	missense	possibly damaging	0.95
R4345:Astn1	UTSW	1	158,329,602 (GRCm39)	splice site	probably null
R4625:Astn1	UTSW	1	158,407,864 (GRCm39)	missense	probably damaging	1.00
R4627:Astn1	UTSW	1	158,329,821 (GRCm39)	missense	possibly damaging	0.55
R4970:Astn1	UTSW	1	158,484,763 (GRCm39)	missense	possibly damaging	0.88
R5112:Astn1	UTSW	1	158,484,763 (GRCm39)	missense	possibly damaging	0.88
R5257:Astn1	UTSW	1	158,440,102 (GRCm39)	missense	probably damaging	1.00
R5292:Astn1	UTSW	1	158,407,933 (GRCm39)	critical splice donor site	probably null
R5889:Astn1	UTSW	1	158,427,950 (GRCm39)	missense	possibly damaging	0.93
R5909:Astn1	UTSW	1	158,429,507 (GRCm39)	missense	probably damaging	1.00
R6020:Astn1	UTSW	1	158,337,563 (GRCm39)	missense	probably damaging	1.00
R6349:Astn1	UTSW	1	158,491,691 (GRCm39)	nonsense	probably null
R6481:Astn1	UTSW	1	158,440,032 (GRCm39)	missense	probably benign	0.29
R6736:Astn1	UTSW	1	158,338,718 (GRCm39)	critical splice donor site	probably null
R6833:Astn1	UTSW	1	158,491,692 (GRCm39)	missense	probably benign	0.40
R6834:Astn1	UTSW	1	158,491,692 (GRCm39)	missense	probably benign	0.40
R6860:Astn1	UTSW	1	158,440,042 (GRCm39)	missense	probably damaging	1.00
R6874:Astn1	UTSW	1	158,491,644 (GRCm39)	nonsense	probably null
R7062:Astn1	UTSW	1	158,516,081 (GRCm39)	critical splice acceptor site	probably null
R7133:Astn1	UTSW	1	158,400,557 (GRCm39)	missense	probably damaging	1.00
R7355:Astn1	UTSW	1	158,491,846 (GRCm39)	splice site	probably null
R7402:Astn1	UTSW	1	158,380,425 (GRCm39)	intron	probably benign
R7412:Astn1	UTSW	1	158,329,919 (GRCm39)	missense	probably damaging	0.98
R7487:Astn1	UTSW	1	158,438,352 (GRCm39)	splice site	probably null
R7537:Astn1	UTSW	1	158,495,208 (GRCm39)	splice site	probably null
R7537:Astn1	UTSW	1	158,332,956 (GRCm39)	missense	possibly damaging	0.84
R7635:Astn1	UTSW	1	158,495,105 (GRCm39)	nonsense	probably null
R7890:Astn1	UTSW	1	158,407,903 (GRCm39)	missense	probably damaging	1.00
R7894:Astn1	UTSW	1	158,429,508 (GRCm39)	missense	probably damaging	0.98
R7904:Astn1	UTSW	1	158,424,886 (GRCm39)	missense	probably benign	0.37
R8048:Astn1	UTSW	1	158,516,208 (GRCm39)	missense	probably benign	0.00
R8061:Astn1	UTSW	1	158,331,920 (GRCm39)	critical splice donor site	probably null
R8096:Astn1	UTSW	1	158,436,890 (GRCm39)	missense	probably damaging	1.00
R8327:Astn1	UTSW	1	158,436,850 (GRCm39)	missense	probably damaging	1.00
R8374:Astn1	UTSW	1	158,329,803 (GRCm39)	missense	probably damaging	1.00
R8400:Astn1	UTSW	1	158,484,670 (GRCm39)	missense	probably benign	0.09
R8983:Astn1	UTSW	1	158,491,700 (GRCm39)	critical splice donor site	probably null
R9013:Astn1	UTSW	1	158,348,070 (GRCm39)	missense	probably damaging	1.00
R9110:Astn1	UTSW	1	158,496,327 (GRCm39)	missense	probably benign	0.01
R9156:Astn1	UTSW	1	158,338,555 (GRCm39)	missense	probably damaging	0.99
R9355:Astn1	UTSW	1	158,511,721 (GRCm39)	missense	probably damaging	1.00
R9683:Astn1	UTSW	1	158,491,619 (GRCm39)	missense	possibly damaging	0.93
Z1088:Astn1	UTSW	1	158,511,666 (GRCm39)	nonsense	probably null
Z1088:Astn1	UTSW	1	158,424,776 (GRCm39)	missense	possibly damaging	0.91
Z1088:Astn1	UTSW	1	158,300,067 (GRCm39)	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- TGTCAAAGTTGAGGTGGTGACATAG -3'
(R):5'- ACTTTGTCAGATGCTCACCCTG -3'

Sequencing Primer
(F):5'- TGACATAGGTCCCAGCTGAGTTC -3'
(R):5'- CCCTGCAAAAACTCTTAAGTGG -3'

Posted On

2014-09-18