Incidental Mutation 'R2094:Casd1'
ID231967
Institutional Source Beutler Lab
Gene Symbol Casd1
Ensembl Gene ENSMUSG00000015189
Gene NameCAS1 domain containing 1
SynonymsCast1
MMRRC Submission 040098-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock #R2094 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location4600839-4643355 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4608705 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 101 (Y101C)
Ref Sequence ENSEMBL: ENSMUSP00000015333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015333] [ENSMUST00000153963] [ENSMUST00000181734]
Predicted Effect probably damaging
Transcript: ENSMUST00000015333
AA Change: Y101C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015333
Gene: ENSMUSG00000015189
AA Change: Y101C

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
Pfam:PC-Esterase 71 292 6.3e-33 PFAM
Pfam:Cas1_AcylT 295 776 9.4e-220 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000141359
AA Change: Y89C
SMART Domains Protein: ENSMUSP00000115427
Gene: ENSMUSG00000015189
AA Change: Y89C

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:PC-Esterase 60 113 1.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153963
SMART Domains Protein: ENSMUSP00000145445
Gene: ENSMUSG00000015189

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000181734
AA Change: Y101C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137822
Gene: ENSMUSG00000015189
AA Change: Y101C

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
Pfam:PC-Esterase 74 271 2.9e-18 PFAM
Pfam:Cas1_AcylT 272 402 3.4e-45 PFAM
Pfam:Cas1_AcylT 399 484 3.4e-37 PFAM
Pfam:Cas1_AcylT 480 527 4.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203342
Meta Mutation Damage Score 0.1797 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A G 1: 193,174,846 I169V probably benign Het
Arrdc5 A G 17: 56,297,856 S144P probably benign Het
Astn1 A G 1: 158,667,609 M92V probably benign Het
Atg5 A G 10: 44,319,548 I189M probably damaging Het
Atmin A G 8: 116,957,538 T646A probably damaging Het
Atp1a2 G A 1: 172,287,433 R262W probably damaging Het
Atp6v1g2 A G 17: 35,236,809 K16E probably damaging Het
Bex6 G A 16: 32,186,460 E29K possibly damaging Het
Cdx1 T C 18: 61,035,912 D70G possibly damaging Het
Cebpz T C 17: 78,935,554 T224A probably benign Het
Cep170b T C 12: 112,735,730 V319A possibly damaging Het
Chrna2 C T 14: 66,149,463 R353W possibly damaging Het
Chst5 A T 8: 111,890,544 V148E probably benign Het
Clhc1 T A 11: 29,557,771 W162R probably benign Het
Csmd1 T A 8: 16,079,978 Q1710L probably damaging Het
Ddb1 A C 19: 10,612,936 M276L probably benign Het
Dot1l C T 10: 80,785,878 R455C probably damaging Het
Dync2h1 A G 9: 7,148,735 V903A probably benign Het
Eno1b T C 18: 48,047,475 V240A possibly damaging Het
Erich1 T G 8: 14,090,527 probably benign Het
Ermp1 A C 19: 29,639,928 S227A probably benign Het
Etv1 C A 12: 38,835,116 P143Q probably null Het
Gimap8 A T 6: 48,650,568 I159F probably benign Het
Gm12666 A G 4: 92,191,656 S32P probably damaging Het
Gm8251 A C 1: 44,059,730 I736S probably benign Het
Gpr4 G A 7: 19,222,578 V142M possibly damaging Het
Gucy1a1 C T 3: 82,113,332 C86Y probably benign Het
Ifngr2 T G 16: 91,561,779 probably null Het
Insrr A T 3: 87,803,181 N398I probably damaging Het
Iws1 A G 18: 32,084,666 E441G probably damaging Het
Megf10 A T 18: 57,281,713 K732* probably null Het
Mprip T A 11: 59,749,508 probably benign Het
Mrgprb8 T C 7: 48,389,205 V208A probably benign Het
Msc G C 1: 14,755,684 P22R probably benign Het
Olfr725 A T 14: 50,034,714 S230T probably damaging Het
Opcml G A 9: 28,901,590 E193K probably damaging Het
Oxsr1 A C 9: 119,294,494 H71Q probably benign Het
Pkp2 T A 16: 16,246,967 W452R probably damaging Het
Prrc2b C T 2: 32,182,570 T20I probably damaging Het
Rasgrp3 T C 17: 75,503,141 S279P probably damaging Het
Rtl1 T A 12: 109,591,397 D1336V unknown Het
Serpina3m G T 12: 104,389,270 K65N probably benign Het
Serpine2 A G 1: 79,810,694 V182A probably damaging Het
Slc10a1 A G 12: 80,956,048 V272A possibly damaging Het
Slc25a29 A T 12: 108,827,432 N73K probably damaging Het
Slit1 G A 19: 41,606,380 R1184W probably damaging Het
Srrm2 T C 17: 23,812,429 probably benign Het
Stk11ip A G 1: 75,525,521 probably benign Het
Tcerg1 A G 18: 42,564,145 K767R possibly damaging Het
Tmem82 T C 4: 141,616,287 K224R probably benign Het
Tmprss11g A G 5: 86,499,556 L41S probably damaging Het
Trim42 T C 9: 97,366,097 N182S probably benign Het
Ttn T C 2: 76,830,088 T7430A probably benign Het
Wwp1 T C 4: 19,650,390 T259A probably benign Het
Other mutations in Casd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Casd1 APN 6 4607979 splice site probably benign
IGL00788:Casd1 APN 6 4624400 missense probably benign 0.30
IGL01161:Casd1 APN 6 4619833 missense possibly damaging 0.68
IGL01558:Casd1 APN 6 4624143 missense possibly damaging 0.56
IGL02124:Casd1 APN 6 4624142 missense probably benign 0.26
IGL02550:Casd1 APN 6 4642009 missense probably benign 0.03
IGL02822:Casd1 APN 6 4630017 missense probably damaging 1.00
IGL02957:Casd1 APN 6 4634068 missense possibly damaging 0.84
IGL03113:Casd1 APN 6 4640951 missense probably damaging 0.99
IGL03138:Casd1 UTSW 6 4613236 missense probably damaging 1.00
R0653:Casd1 UTSW 6 4608075 missense probably benign 0.00
R0673:Casd1 UTSW 6 4624440 missense possibly damaging 0.68
R0729:Casd1 UTSW 6 4619753 splice site probably benign
R0742:Casd1 UTSW 6 4635888 critical splice donor site probably null
R0941:Casd1 UTSW 6 4635848 missense probably damaging 1.00
R1056:Casd1 UTSW 6 4641967 missense probably benign 0.03
R1390:Casd1 UTSW 6 4641859 missense probably benign 0.04
R1394:Casd1 UTSW 6 4624117 missense probably damaging 1.00
R1643:Casd1 UTSW 6 4621243 missense probably benign 0.06
R1653:Casd1 UTSW 6 4624134 missense probably benign 0.00
R1713:Casd1 UTSW 6 4624104 missense probably damaging 1.00
R1861:Casd1 UTSW 6 4640951 missense probably damaging 0.99
R1906:Casd1 UTSW 6 4641979 missense probably damaging 1.00
R3793:Casd1 UTSW 6 4619876 missense possibly damaging 0.90
R3896:Casd1 UTSW 6 4640980 missense probably damaging 1.00
R4519:Casd1 UTSW 6 4621102 missense probably benign 0.00
R4610:Casd1 UTSW 6 4631165 critical splice donor site probably null
R4673:Casd1 UTSW 6 4629975 missense probably damaging 0.97
R4819:Casd1 UTSW 6 4621225 missense probably damaging 0.99
R5920:Casd1 UTSW 6 4641853 missense probably null 1.00
R5929:Casd1 UTSW 6 4629993 missense probably damaging 1.00
R6130:Casd1 UTSW 6 4641948 missense probably damaging 1.00
R6181:Casd1 UTSW 6 4619331 missense probably damaging 1.00
R6291:Casd1 UTSW 6 4619834 missense probably damaging 0.96
R6305:Casd1 UTSW 6 4641892 missense probably damaging 1.00
R7147:Casd1 UTSW 6 4624187 missense probably benign 0.07
R7150:Casd1 UTSW 6 4624211 missense probably benign 0.01
R7657:Casd1 UTSW 6 4619773 missense probably benign 0.00
R8033:Casd1 UTSW 6 4619773 missense probably benign 0.00
X0021:Casd1 UTSW 6 4641935 missense probably damaging 1.00
Z1177:Casd1 UTSW 6 4631531
Predicted Primers PCR Primer
(F):5'- GTGTGACTGGCTGTCTAACA -3'
(R):5'- GTAAGAGATGGCTGGGGCTG -3'

Sequencing Primer
(F):5'- CTAACAGTTTATACTGTTTTATCCt -3'
(R):5'- CTGGGCTGGGGCTGGGCT -3'
Posted On2014-09-18