Incidental Mutation 'R2094:Gpr4'
ID231969
Institutional Source Beutler Lab
Gene Symbol Gpr4
Ensembl Gene ENSMUSG00000044317
Gene NameG protein-coupled receptor 4
Synonyms
MMRRC Submission 040098-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R2094 (G1)
Quality Score173
Status Validated
Chromosome7
Chromosomal Location19212538-19224174 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 19222578 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 142 (V142M)
Ref Sequence ENSEMBL: ENSMUSP00000061243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060225]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060225
AA Change: V142M

PolyPhen 2 Score 0.579 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000061243
Gene: ENSMUSG00000044317
AA Change: V142M

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 27 302 2.8e-6 PFAM
Pfam:7tm_1 36 288 2.9e-39 PFAM
low complexity region 330 341 N/A INTRINSIC
Meta Mutation Damage Score 0.2069 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display partial neonatal and postnatal lethality, hemorrhages, impaired association of vascular smooth muscle cells with capillaries and small arteries and veins, and impaired contact between mesangial cells and renal glomerular capillaries. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A G 1: 193,174,846 I169V probably benign Het
Arrdc5 A G 17: 56,297,856 S144P probably benign Het
Astn1 A G 1: 158,667,609 M92V probably benign Het
Atg5 A G 10: 44,319,548 I189M probably damaging Het
Atmin A G 8: 116,957,538 T646A probably damaging Het
Atp1a2 G A 1: 172,287,433 R262W probably damaging Het
Atp6v1g2 A G 17: 35,236,809 K16E probably damaging Het
Bex6 G A 16: 32,186,460 E29K possibly damaging Het
Casd1 A G 6: 4,608,705 Y101C probably damaging Het
Cdx1 T C 18: 61,035,912 D70G possibly damaging Het
Cebpz T C 17: 78,935,554 T224A probably benign Het
Cep170b T C 12: 112,735,730 V319A possibly damaging Het
Chrna2 C T 14: 66,149,463 R353W possibly damaging Het
Chst5 A T 8: 111,890,544 V148E probably benign Het
Clhc1 T A 11: 29,557,771 W162R probably benign Het
Csmd1 T A 8: 16,079,978 Q1710L probably damaging Het
Ddb1 A C 19: 10,612,936 M276L probably benign Het
Dot1l C T 10: 80,785,878 R455C probably damaging Het
Dync2h1 A G 9: 7,148,735 V903A probably benign Het
Eno1b T C 18: 48,047,475 V240A possibly damaging Het
Erich1 T G 8: 14,090,527 probably benign Het
Ermp1 A C 19: 29,639,928 S227A probably benign Het
Etv1 C A 12: 38,835,116 P143Q probably null Het
Gimap8 A T 6: 48,650,568 I159F probably benign Het
Gm12666 A G 4: 92,191,656 S32P probably damaging Het
Gm8251 A C 1: 44,059,730 I736S probably benign Het
Gucy1a1 C T 3: 82,113,332 C86Y probably benign Het
Ifngr2 T G 16: 91,561,779 probably null Het
Insrr A T 3: 87,803,181 N398I probably damaging Het
Iws1 A G 18: 32,084,666 E441G probably damaging Het
Megf10 A T 18: 57,281,713 K732* probably null Het
Mprip T A 11: 59,749,508 probably benign Het
Mrgprb8 T C 7: 48,389,205 V208A probably benign Het
Msc G C 1: 14,755,684 P22R probably benign Het
Olfr725 A T 14: 50,034,714 S230T probably damaging Het
Opcml G A 9: 28,901,590 E193K probably damaging Het
Oxsr1 A C 9: 119,294,494 H71Q probably benign Het
Pkp2 T A 16: 16,246,967 W452R probably damaging Het
Prrc2b C T 2: 32,182,570 T20I probably damaging Het
Rasgrp3 T C 17: 75,503,141 S279P probably damaging Het
Rtl1 T A 12: 109,591,397 D1336V unknown Het
Serpina3m G T 12: 104,389,270 K65N probably benign Het
Serpine2 A G 1: 79,810,694 V182A probably damaging Het
Slc10a1 A G 12: 80,956,048 V272A possibly damaging Het
Slc25a29 A T 12: 108,827,432 N73K probably damaging Het
Slit1 G A 19: 41,606,380 R1184W probably damaging Het
Srrm2 T C 17: 23,812,429 probably benign Het
Stk11ip A G 1: 75,525,521 probably benign Het
Tcerg1 A G 18: 42,564,145 K767R possibly damaging Het
Tmem82 T C 4: 141,616,287 K224R probably benign Het
Tmprss11g A G 5: 86,499,556 L41S probably damaging Het
Trim42 T C 9: 97,366,097 N182S probably benign Het
Ttn T C 2: 76,830,088 T7430A probably benign Het
Wwp1 T C 4: 19,650,390 T259A probably benign Het
Other mutations in Gpr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1628:Gpr4 UTSW 7 19223199 missense probably benign
R1878:Gpr4 UTSW 7 19223124 missense probably damaging 1.00
R2117:Gpr4 UTSW 7 19223145 missense probably damaging 0.98
R4448:Gpr4 UTSW 7 19223001 missense probably damaging 1.00
R4705:Gpr4 UTSW 7 19222894 missense probably damaging 1.00
R6815:Gpr4 UTSW 7 19222635 missense probably damaging 0.98
R7191:Gpr4 UTSW 7 19223230 missense probably benign
R7196:Gpr4 UTSW 7 19223164 missense probably benign 0.10
R7733:Gpr4 UTSW 7 19222710 missense probably damaging 1.00
R7752:Gpr4 UTSW 7 19222415 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTGCACTTTGCCGCTGTG -3'
(R):5'- TAGCACAGCAACATGAGTGCC -3'

Sequencing Primer
(F):5'- GCTGTGGGTCGACTACTTCC -3'
(R):5'- CAACATGAGTGCCCAGGG -3'
Posted On2014-09-18