Incidental Mutation 'R2094:Erich1'
ID231971
Institutional Source Beutler Lab
Gene Symbol Erich1
Ensembl Gene ENSMUSG00000051978
Gene Nameglutamate rich 1
Synonyms
MMRRC Submission 040098-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R2094 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location14027561-14090301 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to G at 14090527 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110813] [ENSMUST00000211242]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098916
SMART Domains Protein: ENSMUSP00000096516
Gene: ENSMUSG00000074461

DomainStartEndE-ValueType
low complexity region 50 63 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110813
SMART Domains Protein: ENSMUSP00000106436
Gene: ENSMUSG00000051978

DomainStartEndE-ValueType
low complexity region 110 121 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
low complexity region 188 209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211242
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A G 1: 193,174,846 I169V probably benign Het
Arrdc5 A G 17: 56,297,856 S144P probably benign Het
Astn1 A G 1: 158,667,609 M92V probably benign Het
Atg5 A G 10: 44,319,548 I189M probably damaging Het
Atmin A G 8: 116,957,538 T646A probably damaging Het
Atp1a2 G A 1: 172,287,433 R262W probably damaging Het
Atp6v1g2 A G 17: 35,236,809 K16E probably damaging Het
Bex6 G A 16: 32,186,460 E29K possibly damaging Het
Casd1 A G 6: 4,608,705 Y101C probably damaging Het
Cdx1 T C 18: 61,035,912 D70G possibly damaging Het
Cebpz T C 17: 78,935,554 T224A probably benign Het
Cep170b T C 12: 112,735,730 V319A possibly damaging Het
Chrna2 C T 14: 66,149,463 R353W possibly damaging Het
Chst5 A T 8: 111,890,544 V148E probably benign Het
Clhc1 T A 11: 29,557,771 W162R probably benign Het
Csmd1 T A 8: 16,079,978 Q1710L probably damaging Het
Ddb1 A C 19: 10,612,936 M276L probably benign Het
Dot1l C T 10: 80,785,878 R455C probably damaging Het
Dync2h1 A G 9: 7,148,735 V903A probably benign Het
Eno1b T C 18: 48,047,475 V240A possibly damaging Het
Ermp1 A C 19: 29,639,928 S227A probably benign Het
Etv1 C A 12: 38,835,116 P143Q probably null Het
Gimap8 A T 6: 48,650,568 I159F probably benign Het
Gm12666 A G 4: 92,191,656 S32P probably damaging Het
Gm8251 A C 1: 44,059,730 I736S probably benign Het
Gpr4 G A 7: 19,222,578 V142M possibly damaging Het
Gucy1a1 C T 3: 82,113,332 C86Y probably benign Het
Ifngr2 T G 16: 91,561,779 probably null Het
Insrr A T 3: 87,803,181 N398I probably damaging Het
Iws1 A G 18: 32,084,666 E441G probably damaging Het
Megf10 A T 18: 57,281,713 K732* probably null Het
Mprip T A 11: 59,749,508 probably benign Het
Mrgprb8 T C 7: 48,389,205 V208A probably benign Het
Msc G C 1: 14,755,684 P22R probably benign Het
Olfr725 A T 14: 50,034,714 S230T probably damaging Het
Opcml G A 9: 28,901,590 E193K probably damaging Het
Oxsr1 A C 9: 119,294,494 H71Q probably benign Het
Pkp2 T A 16: 16,246,967 W452R probably damaging Het
Prrc2b C T 2: 32,182,570 T20I probably damaging Het
Rasgrp3 T C 17: 75,503,141 S279P probably damaging Het
Rtl1 T A 12: 109,591,397 D1336V unknown Het
Serpina3m G T 12: 104,389,270 K65N probably benign Het
Serpine2 A G 1: 79,810,694 V182A probably damaging Het
Slc10a1 A G 12: 80,956,048 V272A possibly damaging Het
Slc25a29 A T 12: 108,827,432 N73K probably damaging Het
Slit1 G A 19: 41,606,380 R1184W probably damaging Het
Srrm2 T C 17: 23,812,429 probably benign Het
Stk11ip A G 1: 75,525,521 probably benign Het
Tcerg1 A G 18: 42,564,145 K767R possibly damaging Het
Tmem82 T C 4: 141,616,287 K224R probably benign Het
Tmprss11g A G 5: 86,499,556 L41S probably damaging Het
Trim42 T C 9: 97,366,097 N182S probably benign Het
Ttn T C 2: 76,830,088 T7430A probably benign Het
Wwp1 T C 4: 19,650,390 T259A probably benign Het
Other mutations in Erich1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Erich1 APN 8 14033770 splice site probably benign
IGL00927:Erich1 APN 8 14033518 missense probably damaging 1.00
IGL01448:Erich1 APN 8 14078853 missense possibly damaging 0.95
R1165:Erich1 UTSW 8 14090530 unclassified probably benign
R1541:Erich1 UTSW 8 14030688 missense probably damaging 0.97
R1699:Erich1 UTSW 8 14090259 missense possibly damaging 0.73
R2153:Erich1 UTSW 8 14078773 missense probably benign 0.08
R3807:Erich1 UTSW 8 14033695 missense probably benign 0.11
R5787:Erich1 UTSW 8 14033776 splice site probably null
R6119:Erich1 UTSW 8 14033692 missense probably benign
R7034:Erich1 UTSW 8 14064330 missense probably benign 0.02
R7363:Erich1 UTSW 8 14033688 missense probably benign 0.05
R7687:Erich1 UTSW 8 14030691 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAATCCGGACCCGAATTCCC -3'
(R):5'- TCGTAGACGCGAAACAGATG -3'

Sequencing Primer
(F):5'- CCGCCGCTGGATGTCAATC -3'
(R):5'- TGCAGCGGTACAACTGG -3'
Posted On2014-09-18