Incidental Mutation 'R2094:Trim42'
ID231978
Institutional Source Beutler Lab
Gene Symbol Trim42
Ensembl Gene ENSMUSG00000032451
Gene Nametripartite motif-containing 42
Synonyms
MMRRC Submission 040098-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R2094 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location97349562-97369958 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97366097 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 182 (N182S)
Ref Sequence ENSEMBL: ENSMUSP00000035026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035026]
Predicted Effect probably benign
Transcript: ENSMUST00000035026
AA Change: N182S

PolyPhen 2 Score 0.230 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000035026
Gene: ENSMUSG00000032451
AA Change: N182S

DomainStartEndE-ValueType
RING 146 191 3.67e-3 SMART
BBOX 233 280 1.42e0 SMART
BBOX 285 326 1.04e-2 SMART
low complexity region 386 399 N/A INTRINSIC
FN3 603 688 2.44e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127307
Meta Mutation Damage Score 0.0959 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, namely a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A G 1: 193,174,846 I169V probably benign Het
Arrdc5 A G 17: 56,297,856 S144P probably benign Het
Astn1 A G 1: 158,667,609 M92V probably benign Het
Atg5 A G 10: 44,319,548 I189M probably damaging Het
Atmin A G 8: 116,957,538 T646A probably damaging Het
Atp1a2 G A 1: 172,287,433 R262W probably damaging Het
Atp6v1g2 A G 17: 35,236,809 K16E probably damaging Het
Bex6 G A 16: 32,186,460 E29K possibly damaging Het
Casd1 A G 6: 4,608,705 Y101C probably damaging Het
Cdx1 T C 18: 61,035,912 D70G possibly damaging Het
Cebpz T C 17: 78,935,554 T224A probably benign Het
Cep170b T C 12: 112,735,730 V319A possibly damaging Het
Chrna2 C T 14: 66,149,463 R353W possibly damaging Het
Chst5 A T 8: 111,890,544 V148E probably benign Het
Clhc1 T A 11: 29,557,771 W162R probably benign Het
Csmd1 T A 8: 16,079,978 Q1710L probably damaging Het
Ddb1 A C 19: 10,612,936 M276L probably benign Het
Dot1l C T 10: 80,785,878 R455C probably damaging Het
Dync2h1 A G 9: 7,148,735 V903A probably benign Het
Eno1b T C 18: 48,047,475 V240A possibly damaging Het
Erich1 T G 8: 14,090,527 probably benign Het
Ermp1 A C 19: 29,639,928 S227A probably benign Het
Etv1 C A 12: 38,835,116 P143Q probably null Het
Gimap8 A T 6: 48,650,568 I159F probably benign Het
Gm12666 A G 4: 92,191,656 S32P probably damaging Het
Gm8251 A C 1: 44,059,730 I736S probably benign Het
Gpr4 G A 7: 19,222,578 V142M possibly damaging Het
Gucy1a1 C T 3: 82,113,332 C86Y probably benign Het
Ifngr2 T G 16: 91,561,779 probably null Het
Insrr A T 3: 87,803,181 N398I probably damaging Het
Iws1 A G 18: 32,084,666 E441G probably damaging Het
Megf10 A T 18: 57,281,713 K732* probably null Het
Mprip T A 11: 59,749,508 probably benign Het
Mrgprb8 T C 7: 48,389,205 V208A probably benign Het
Msc G C 1: 14,755,684 P22R probably benign Het
Olfr725 A T 14: 50,034,714 S230T probably damaging Het
Opcml G A 9: 28,901,590 E193K probably damaging Het
Oxsr1 A C 9: 119,294,494 H71Q probably benign Het
Pkp2 T A 16: 16,246,967 W452R probably damaging Het
Prrc2b C T 2: 32,182,570 T20I probably damaging Het
Rasgrp3 T C 17: 75,503,141 S279P probably damaging Het
Rtl1 T A 12: 109,591,397 D1336V unknown Het
Serpina3m G T 12: 104,389,270 K65N probably benign Het
Serpine2 A G 1: 79,810,694 V182A probably damaging Het
Slc10a1 A G 12: 80,956,048 V272A possibly damaging Het
Slc25a29 A T 12: 108,827,432 N73K probably damaging Het
Slit1 G A 19: 41,606,380 R1184W probably damaging Het
Srrm2 T C 17: 23,812,429 probably benign Het
Stk11ip A G 1: 75,525,521 probably benign Het
Tcerg1 A G 18: 42,564,145 K767R possibly damaging Het
Tmem82 T C 4: 141,616,287 K224R probably benign Het
Tmprss11g A G 5: 86,499,556 L41S probably damaging Het
Ttn T C 2: 76,830,088 T7430A probably benign Het
Wwp1 T C 4: 19,650,390 T259A probably benign Het
Other mutations in Trim42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02289:Trim42 APN 9 97359233 missense probably damaging 0.97
IGL02987:Trim42 APN 9 97365815 missense probably benign 0.28
R0116:Trim42 UTSW 9 97363403 missense possibly damaging 0.89
R0791:Trim42 UTSW 9 97365679 missense probably damaging 1.00
R1170:Trim42 UTSW 9 97363620 missense probably benign 0.04
R1397:Trim42 UTSW 9 97365621 missense probably damaging 1.00
R1499:Trim42 UTSW 9 97366085 missense possibly damaging 0.95
R1522:Trim42 UTSW 9 97365679 missense probably damaging 1.00
R2355:Trim42 UTSW 9 97359240 missense probably damaging 1.00
R4621:Trim42 UTSW 9 97363148 missense probably benign
R4649:Trim42 UTSW 9 97362945 missense probably benign 0.00
R4840:Trim42 UTSW 9 97362929 missense probably benign 0.02
R6147:Trim42 UTSW 9 97363329 missense probably benign
R7048:Trim42 UTSW 9 97363421 missense probably damaging 1.00
R7235:Trim42 UTSW 9 97369708 missense probably damaging 0.99
R7276:Trim42 UTSW 9 97369572 nonsense probably null
R7390:Trim42 UTSW 9 97359129 missense probably damaging 1.00
R7442:Trim42 UTSW 9 97362945 missense probably damaging 0.97
R7650:Trim42 UTSW 9 97363148 missense probably benign
R7881:Trim42 UTSW 9 97363017 missense possibly damaging 0.83
R7964:Trim42 UTSW 9 97363017 missense possibly damaging 0.83
Z1088:Trim42 UTSW 9 97369622 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCACAGGTTGAGACGACAG -3'
(R):5'- TACTCAGATGGATGAACCCAAGAC -3'

Sequencing Primer
(F):5'- CACAGCGCTTGTAGGCAATG -3'
(R):5'- GATGGATGAACCCAAGACCATGC -3'
Posted On2014-09-18