Incidental Mutation 'R2094:Oxsr1'
ID231979
Institutional Source Beutler Lab
Gene Symbol Oxsr1
Ensembl Gene ENSMUSG00000036737
Gene Nameoxidative-stress responsive 1
Synonyms2210022N24Rik, Osr1, 2810422B09Rik
MMRRC Submission 040098-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2094 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location119238432-119322427 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 119294494 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 71 (H71Q)
Ref Sequence ENSEMBL: ENSMUSP00000042155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040853] [ENSMUST00000128880] [ENSMUST00000170400]
Predicted Effect probably benign
Transcript: ENSMUST00000040853
AA Change: H71Q

PolyPhen 2 Score 0.224 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000042155
Gene: ENSMUSG00000036737
AA Change: H71Q

DomainStartEndE-ValueType
S_TKc 17 291 1.45e-84 SMART
low complexity region 332 350 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 410 421 N/A INTRINSIC
Pfam:OSR1_C 434 465 3.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128880
AA Change: H71Q

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000122692
Gene: ENSMUSG00000036737
AA Change: H71Q

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 17 100 6.3e-13 PFAM
Pfam:Pkinase 17 111 1.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170400
SMART Domains Protein: ENSMUSP00000131982
Gene: ENSMUSG00000070280

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Sugar_tr 150 555 1.2e-28 PFAM
Pfam:MFS_1 178 514 7.6e-28 PFAM
Meta Mutation Damage Score 0.0688 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the Ser/Thr protein kinase family of proteins. It regulates downstream kinases in response to environmental stress, and may play a role in regulating the actin cytoskeleton. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are embryonic lethal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A G 1: 193,174,846 I169V probably benign Het
Arrdc5 A G 17: 56,297,856 S144P probably benign Het
Astn1 A G 1: 158,667,609 M92V probably benign Het
Atg5 A G 10: 44,319,548 I189M probably damaging Het
Atmin A G 8: 116,957,538 T646A probably damaging Het
Atp1a2 G A 1: 172,287,433 R262W probably damaging Het
Atp6v1g2 A G 17: 35,236,809 K16E probably damaging Het
Bex6 G A 16: 32,186,460 E29K possibly damaging Het
Casd1 A G 6: 4,608,705 Y101C probably damaging Het
Cdx1 T C 18: 61,035,912 D70G possibly damaging Het
Cebpz T C 17: 78,935,554 T224A probably benign Het
Cep170b T C 12: 112,735,730 V319A possibly damaging Het
Chrna2 C T 14: 66,149,463 R353W possibly damaging Het
Chst5 A T 8: 111,890,544 V148E probably benign Het
Clhc1 T A 11: 29,557,771 W162R probably benign Het
Csmd1 T A 8: 16,079,978 Q1710L probably damaging Het
Ddb1 A C 19: 10,612,936 M276L probably benign Het
Dot1l C T 10: 80,785,878 R455C probably damaging Het
Dync2h1 A G 9: 7,148,735 V903A probably benign Het
Eno1b T C 18: 48,047,475 V240A possibly damaging Het
Erich1 T G 8: 14,090,527 probably benign Het
Ermp1 A C 19: 29,639,928 S227A probably benign Het
Etv1 C A 12: 38,835,116 P143Q probably null Het
Gimap8 A T 6: 48,650,568 I159F probably benign Het
Gm12666 A G 4: 92,191,656 S32P probably damaging Het
Gm8251 A C 1: 44,059,730 I736S probably benign Het
Gpr4 G A 7: 19,222,578 V142M possibly damaging Het
Gucy1a1 C T 3: 82,113,332 C86Y probably benign Het
Ifngr2 T G 16: 91,561,779 probably null Het
Insrr A T 3: 87,803,181 N398I probably damaging Het
Iws1 A G 18: 32,084,666 E441G probably damaging Het
Megf10 A T 18: 57,281,713 K732* probably null Het
Mprip T A 11: 59,749,508 probably benign Het
Mrgprb8 T C 7: 48,389,205 V208A probably benign Het
Msc G C 1: 14,755,684 P22R probably benign Het
Olfr725 A T 14: 50,034,714 S230T probably damaging Het
Opcml G A 9: 28,901,590 E193K probably damaging Het
Pkp2 T A 16: 16,246,967 W452R probably damaging Het
Prrc2b C T 2: 32,182,570 T20I probably damaging Het
Rasgrp3 T C 17: 75,503,141 S279P probably damaging Het
Rtl1 T A 12: 109,591,397 D1336V unknown Het
Serpina3m G T 12: 104,389,270 K65N probably benign Het
Serpine2 A G 1: 79,810,694 V182A probably damaging Het
Slc10a1 A G 12: 80,956,048 V272A possibly damaging Het
Slc25a29 A T 12: 108,827,432 N73K probably damaging Het
Slit1 G A 19: 41,606,380 R1184W probably damaging Het
Srrm2 T C 17: 23,812,429 probably benign Het
Stk11ip A G 1: 75,525,521 probably benign Het
Tcerg1 A G 18: 42,564,145 K767R possibly damaging Het
Tmem82 T C 4: 141,616,287 K224R probably benign Het
Tmprss11g A G 5: 86,499,556 L41S probably damaging Het
Trim42 T C 9: 97,366,097 N182S probably benign Het
Ttn T C 2: 76,830,088 T7430A probably benign Het
Wwp1 T C 4: 19,650,390 T259A probably benign Het
Other mutations in Oxsr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Oxsr1 APN 9 119259211 missense probably damaging 1.00
IGL01380:Oxsr1 APN 9 119260101 intron probably benign
IGL02542:Oxsr1 APN 9 119242735 missense possibly damaging 0.67
IGL02806:Oxsr1 APN 9 119241194 missense possibly damaging 0.55
R0629:Oxsr1 UTSW 9 119241784 intron probably benign
R2048:Oxsr1 UTSW 9 119247074 missense probably benign
R2159:Oxsr1 UTSW 9 119304814 missense possibly damaging 0.52
R2165:Oxsr1 UTSW 9 119294432 missense probably damaging 1.00
R3905:Oxsr1 UTSW 9 119247112 missense probably benign
R6017:Oxsr1 UTSW 9 119264777 missense probably benign 0.00
R6286:Oxsr1 UTSW 9 119264882 missense probably damaging 0.99
R6899:Oxsr1 UTSW 9 119247122 missense probably benign 0.00
R7091:Oxsr1 UTSW 9 119284661 missense probably benign 0.03
R7683:Oxsr1 UTSW 9 119241755 missense probably benign 0.30
R7715:Oxsr1 UTSW 9 119242756 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATTCTCAGTATCTCCTCAAACG -3'
(R):5'- CCAGTGGAGCCATTCATGAAG -3'

Sequencing Primer
(F):5'- TGGCCTTGAACTCACAGAGATC -3'
(R):5'- AGAAATTAGTTCCTTGGAAATCCCAG -3'
Posted On2014-09-18