Incidental Mutation 'R2094:Atg5'
ID231980
Institutional Source Beutler Lab
Gene Symbol Atg5
Ensembl Gene ENSMUSG00000038160
Gene Nameautophagy related 5
SynonymsPaddy, 3110067M24Rik, Apg5l, 2010107M05Rik
MMRRC Submission 040098-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2094 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location44268358-44364291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44319548 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 189 (I189M)
Ref Sequence ENSEMBL: ENSMUSP00000044769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039286]
Predicted Effect probably damaging
Transcript: ENSMUST00000039286
AA Change: I189M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000044769
Gene: ENSMUSG00000038160
AA Change: I189M

DomainStartEndE-ValueType
Pfam:APG5 79 270 2.6e-64 PFAM
Meta Mutation Damage Score 0.7930 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: The protein encoded by this gene, in combination with autophagy protein 12, functions as an E1-like activating enzyme in a ubiquitin-like conjugating system. The encoded protein is involved in several cellular processes, including autophagic vesicle formation, mitochondrial quality control after oxidative damage, negative regulation of the innate antiviral immune response, lymphocyte development and proliferation, MHC II antigen presentation, adipocyte differentiation, and apoptosis. Two transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutation of this gene results in impaired autophagy due to absence of autolysosomes. Homozygotes die within 1 day of birth, have shorter survival times and reduced amino acid levels under fasting conditions. Homozygotes for a gene trap insertion mutationin this gene show no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A G 1: 193,174,846 I169V probably benign Het
Arrdc5 A G 17: 56,297,856 S144P probably benign Het
Astn1 A G 1: 158,667,609 M92V probably benign Het
Atmin A G 8: 116,957,538 T646A probably damaging Het
Atp1a2 G A 1: 172,287,433 R262W probably damaging Het
Atp6v1g2 A G 17: 35,236,809 K16E probably damaging Het
Bex6 G A 16: 32,186,460 E29K possibly damaging Het
Casd1 A G 6: 4,608,705 Y101C probably damaging Het
Cdx1 T C 18: 61,035,912 D70G possibly damaging Het
Cebpz T C 17: 78,935,554 T224A probably benign Het
Cep170b T C 12: 112,735,730 V319A possibly damaging Het
Chrna2 C T 14: 66,149,463 R353W possibly damaging Het
Chst5 A T 8: 111,890,544 V148E probably benign Het
Clhc1 T A 11: 29,557,771 W162R probably benign Het
Csmd1 T A 8: 16,079,978 Q1710L probably damaging Het
Ddb1 A C 19: 10,612,936 M276L probably benign Het
Dot1l C T 10: 80,785,878 R455C probably damaging Het
Dync2h1 A G 9: 7,148,735 V903A probably benign Het
Eno1b T C 18: 48,047,475 V240A possibly damaging Het
Erich1 T G 8: 14,090,527 probably benign Het
Ermp1 A C 19: 29,639,928 S227A probably benign Het
Etv1 C A 12: 38,835,116 P143Q probably null Het
Gimap8 A T 6: 48,650,568 I159F probably benign Het
Gm12666 A G 4: 92,191,656 S32P probably damaging Het
Gm8251 A C 1: 44,059,730 I736S probably benign Het
Gpr4 G A 7: 19,222,578 V142M possibly damaging Het
Gucy1a1 C T 3: 82,113,332 C86Y probably benign Het
Ifngr2 T G 16: 91,561,779 probably null Het
Insrr A T 3: 87,803,181 N398I probably damaging Het
Iws1 A G 18: 32,084,666 E441G probably damaging Het
Megf10 A T 18: 57,281,713 K732* probably null Het
Mprip T A 11: 59,749,508 probably benign Het
Mrgprb8 T C 7: 48,389,205 V208A probably benign Het
Msc G C 1: 14,755,684 P22R probably benign Het
Olfr725 A T 14: 50,034,714 S230T probably damaging Het
Opcml G A 9: 28,901,590 E193K probably damaging Het
Oxsr1 A C 9: 119,294,494 H71Q probably benign Het
Pkp2 T A 16: 16,246,967 W452R probably damaging Het
Prrc2b C T 2: 32,182,570 T20I probably damaging Het
Rasgrp3 T C 17: 75,503,141 S279P probably damaging Het
Rtl1 T A 12: 109,591,397 D1336V unknown Het
Serpina3m G T 12: 104,389,270 K65N probably benign Het
Serpine2 A G 1: 79,810,694 V182A probably damaging Het
Slc10a1 A G 12: 80,956,048 V272A possibly damaging Het
Slc25a29 A T 12: 108,827,432 N73K probably damaging Het
Slit1 G A 19: 41,606,380 R1184W probably damaging Het
Srrm2 T C 17: 23,812,429 probably benign Het
Stk11ip A G 1: 75,525,521 probably benign Het
Tcerg1 A G 18: 42,564,145 K767R possibly damaging Het
Tmem82 T C 4: 141,616,287 K224R probably benign Het
Tmprss11g A G 5: 86,499,556 L41S probably damaging Het
Trim42 T C 9: 97,366,097 N182S probably benign Het
Ttn T C 2: 76,830,088 T7430A probably benign Het
Wwp1 T C 4: 19,650,390 T259A probably benign Het
Other mutations in Atg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Atg5 APN 10 44363044 missense probably benign 0.00
P0041:Atg5 UTSW 10 44289942 missense probably benign 0.20
R4906:Atg5 UTSW 10 44363050 makesense probably null
R5718:Atg5 UTSW 10 44362987 missense probably benign 0.01
R6194:Atg5 UTSW 10 44294616 missense probably damaging 1.00
R6660:Atg5 UTSW 10 44294655 missense probably benign
R7070:Atg5 UTSW 10 44286154 missense probably damaging 1.00
R7677:Atg5 UTSW 10 44347039 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGTGGCTAAGACTTTACTGTC -3'
(R):5'- CTGTAGCAGGTAGACGAATCAG -3'

Sequencing Primer
(F):5'- CAGTTTTGGGCCATCAAC -3'
(R):5'- AGTAGCAACTATGAGTCACTGC -3'
Posted On2014-09-18