Incidental Mutation 'R2094:Etv1'
ID231984
Institutional Source Beutler Lab
Gene Symbol Etv1
Ensembl Gene ENSMUSG00000004151
Gene Nameets variant 1
SynonymsEtsrp81, ER81
MMRRC Submission 040098-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.383) question?
Stock #R2094 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location38779380-38870484 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 38835116 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 143 (P143Q)
Ref Sequence ENSEMBL: ENSMUSP00000124736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095767] [ENSMUST00000159334] [ENSMUST00000160244] [ENSMUST00000160701] [ENSMUST00000160701] [ENSMUST00000160856] [ENSMUST00000160996] [ENSMUST00000161513] [ENSMUST00000161513] [ENSMUST00000161980] [ENSMUST00000161980] [ENSMUST00000162563]
Predicted Effect probably null
Transcript: ENSMUST00000095767
AA Change: P201Q

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000093442
Gene: ENSMUSG00000004151
AA Change: P201Q

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 1 333 5e-153 PFAM
ETS 334 419 1.72e-57 SMART
Predicted Effect probably null
Transcript: ENSMUST00000159334
AA Change: P161Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125676
Gene: ENSMUSG00000004151
AA Change: P161Q

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 16 293 1.1e-112 PFAM
ETS 294 379 1.72e-57 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160244
AA Change: P201Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125733
Gene: ENSMUSG00000004151
AA Change: P201Q

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 1 310 2.5e-133 PFAM
ETS 311 396 1.72e-57 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160701
AA Change: P98Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124019
Gene: ENSMUSG00000004151
AA Change: P98Q

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 14 82 1.4e-30 PFAM
Pfam:ETS_PEA3_N 80 230 1.6e-68 PFAM
ETS 231 316 1.72e-57 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160701
AA Change: P98Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124019
Gene: ENSMUSG00000004151
AA Change: P98Q

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 14 82 1.4e-30 PFAM
Pfam:ETS_PEA3_N 80 230 1.6e-68 PFAM
ETS 231 316 1.72e-57 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160856
AA Change: P183Q

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125692
Gene: ENSMUSG00000004151
AA Change: P183Q

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 1 315 3.8e-130 PFAM
ETS 316 401 1.72e-57 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160996
AA Change: P183Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124705
Gene: ENSMUSG00000004151
AA Change: P183Q

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 1 230 1.9e-85 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000161513
AA Change: P217Q

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124166
Gene: ENSMUSG00000004151
AA Change: P217Q

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 23 210 8.5e-71 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000161513
AA Change: P217Q

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124166
Gene: ENSMUSG00000004151
AA Change: P217Q

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 23 210 8.5e-71 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161591
Predicted Effect probably null
Transcript: ENSMUST00000161980
AA Change: P143Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124736
Gene: ENSMUSG00000004151
AA Change: P143Q

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 10 275 3.2e-104 PFAM
ETS 276 361 1.72e-57 SMART
Predicted Effect probably null
Transcript: ENSMUST00000161980
AA Change: P143Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124736
Gene: ENSMUSG00000004151
AA Change: P143Q

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 10 275 3.2e-104 PFAM
ETS 276 361 1.72e-57 SMART
Predicted Effect probably null
Transcript: ENSMUST00000162563
AA Change: P201Q

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000125157
Gene: ENSMUSG00000004151
AA Change: P201Q

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 1 333 5.6e-150 PFAM
ETS 334 419 1.72e-57 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220492
Meta Mutation Damage Score 0.1448 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ETS (E twenty-six) family of transcription factors. The ETS proteins regulate many target genes that modulate biological processes like cell growth, angiogenesis, migration, proliferation and differentiation. All ETS proteins contain an ETS DNA-binding domain that binds to DNA sequences containing the consensus 5'-CGGA[AT]-3'. The protein encoded by this gene contains a conserved short acidic transactivation domain (TAD) in the N-terminal region, in addition to the ETS DNA-binding domain in the C-terminal region. This gene is involved in chromosomal translocations, which result in multiple fusion proteins including EWS-ETV1 in Ewing sarcoma and at least 10 ETV1 partners (see PMID: 19657377, Table 1) in prostate cancer. In addition to chromosomal rearrangement, this gene is overexpressed in prostate cancer, melanoma and gastrointestinal stromal tumor. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous inactivation of this gene leads to premature death, ataxia, impaired limb coordination, defects in muscle innervation, muscle spindle differentiation and sensory-motor connectivity, deficient golgi tendon organs, and absence of Pacinian corpuscles and their afferents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A G 1: 193,174,846 I169V probably benign Het
Arrdc5 A G 17: 56,297,856 S144P probably benign Het
Astn1 A G 1: 158,667,609 M92V probably benign Het
Atg5 A G 10: 44,319,548 I189M probably damaging Het
Atmin A G 8: 116,957,538 T646A probably damaging Het
Atp1a2 G A 1: 172,287,433 R262W probably damaging Het
Atp6v1g2 A G 17: 35,236,809 K16E probably damaging Het
Bex6 G A 16: 32,186,460 E29K possibly damaging Het
Casd1 A G 6: 4,608,705 Y101C probably damaging Het
Cdx1 T C 18: 61,035,912 D70G possibly damaging Het
Cebpz T C 17: 78,935,554 T224A probably benign Het
Cep170b T C 12: 112,735,730 V319A possibly damaging Het
Chrna2 C T 14: 66,149,463 R353W possibly damaging Het
Chst5 A T 8: 111,890,544 V148E probably benign Het
Clhc1 T A 11: 29,557,771 W162R probably benign Het
Csmd1 T A 8: 16,079,978 Q1710L probably damaging Het
Ddb1 A C 19: 10,612,936 M276L probably benign Het
Dot1l C T 10: 80,785,878 R455C probably damaging Het
Dync2h1 A G 9: 7,148,735 V903A probably benign Het
Eno1b T C 18: 48,047,475 V240A possibly damaging Het
Erich1 T G 8: 14,090,527 probably benign Het
Ermp1 A C 19: 29,639,928 S227A probably benign Het
Gimap8 A T 6: 48,650,568 I159F probably benign Het
Gm12666 A G 4: 92,191,656 S32P probably damaging Het
Gm8251 A C 1: 44,059,730 I736S probably benign Het
Gpr4 G A 7: 19,222,578 V142M possibly damaging Het
Gucy1a1 C T 3: 82,113,332 C86Y probably benign Het
Ifngr2 T G 16: 91,561,779 probably null Het
Insrr A T 3: 87,803,181 N398I probably damaging Het
Iws1 A G 18: 32,084,666 E441G probably damaging Het
Megf10 A T 18: 57,281,713 K732* probably null Het
Mprip T A 11: 59,749,508 probably benign Het
Mrgprb8 T C 7: 48,389,205 V208A probably benign Het
Msc G C 1: 14,755,684 P22R probably benign Het
Olfr725 A T 14: 50,034,714 S230T probably damaging Het
Opcml G A 9: 28,901,590 E193K probably damaging Het
Oxsr1 A C 9: 119,294,494 H71Q probably benign Het
Pkp2 T A 16: 16,246,967 W452R probably damaging Het
Prrc2b C T 2: 32,182,570 T20I probably damaging Het
Rasgrp3 T C 17: 75,503,141 S279P probably damaging Het
Rtl1 T A 12: 109,591,397 D1336V unknown Het
Serpina3m G T 12: 104,389,270 K65N probably benign Het
Serpine2 A G 1: 79,810,694 V182A probably damaging Het
Slc10a1 A G 12: 80,956,048 V272A possibly damaging Het
Slc25a29 A T 12: 108,827,432 N73K probably damaging Het
Slit1 G A 19: 41,606,380 R1184W probably damaging Het
Srrm2 T C 17: 23,812,429 probably benign Het
Stk11ip A G 1: 75,525,521 probably benign Het
Tcerg1 A G 18: 42,564,145 K767R possibly damaging Het
Tmem82 T C 4: 141,616,287 K224R probably benign Het
Tmprss11g A G 5: 86,499,556 L41S probably damaging Het
Trim42 T C 9: 97,366,097 N182S probably benign Het
Ttn T C 2: 76,830,088 T7430A probably benign Het
Wwp1 T C 4: 19,650,390 T259A probably benign Het
Other mutations in Etv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Etv1 APN 12 38781792 splice site probably benign
IGL01376:Etv1 APN 12 38857040 missense probably damaging 1.00
IGL01387:Etv1 APN 12 38861327 missense probably damaging 0.99
IGL01936:Etv1 APN 12 38835061 splice site probably benign
IGL02388:Etv1 APN 12 38781799 missense possibly damaging 0.62
IGL02933:Etv1 APN 12 38781833 missense probably benign 0.22
R0844:Etv1 UTSW 12 38861354 missense probably damaging 1.00
R0993:Etv1 UTSW 12 38827864 missense probably damaging 1.00
R1187:Etv1 UTSW 12 38865564 missense probably damaging 1.00
R1710:Etv1 UTSW 12 38852262 missense probably benign 0.18
R2879:Etv1 UTSW 12 38783810 splice site probably null
R3607:Etv1 UTSW 12 38831086 missense probably damaging 1.00
R4353:Etv1 UTSW 12 38857106 missense probably damaging 1.00
R4646:Etv1 UTSW 12 38865686 missense possibly damaging 0.94
R4678:Etv1 UTSW 12 38835220 missense probably damaging 1.00
R4768:Etv1 UTSW 12 38827793 missense probably damaging 1.00
R4812:Etv1 UTSW 12 38861288 missense probably damaging 1.00
R4877:Etv1 UTSW 12 38831293 unclassified probably null
R5024:Etv1 UTSW 12 38854234 splice site probably null
R5253:Etv1 UTSW 12 38852249 missense possibly damaging 0.50
R5936:Etv1 UTSW 12 38835210 missense probably damaging 1.00
R6085:Etv1 UTSW 12 38854195 missense probably damaging 1.00
R6167:Etv1 UTSW 12 38865641 missense possibly damaging 0.88
R6709:Etv1 UTSW 12 38783797 missense possibly damaging 0.93
R7046:Etv1 UTSW 12 38784370 intron probably null
R7243:Etv1 UTSW 12 38857046 missense probably benign 0.36
R7616:Etv1 UTSW 12 38865606 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAAATCTGAGGCTCACTAAAGC -3'
(R):5'- TCCATAAGAGGATGGGCATACC -3'

Sequencing Primer
(F):5'- CTGAGGCTCACTAAAGCTATTGAC -3'
(R):5'- ATGGGCATACCTGAGTCATATGC -3'
Posted On2014-09-18