Incidental Mutation 'R2094:Slc10a1'
ID231985
Institutional Source Beutler Lab
Gene Symbol Slc10a1
Ensembl Gene ENSMUSG00000021135
Gene Namesolute carrier family 10 (sodium/bile acid cotransporter family), member 1
SynonymsNtcp, sodium bile acid cotransporting polypeptide
MMRRC Submission 040098-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2094 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location80953183-80968705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80956048 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 272 (V272A)
Ref Sequence ENSEMBL: ENSMUSP00000151215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095572] [ENSMUST00000218162] [ENSMUST00000218342] [ENSMUST00000220266]
Predicted Effect probably benign
Transcript: ENSMUST00000095572
AA Change: V272A

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000093229
Gene: ENSMUSG00000021135
AA Change: V272A

DomainStartEndE-ValueType
Pfam:SBF 32 217 3.3e-47 PFAM
transmembrane domain 222 244 N/A INTRINSIC
transmembrane domain 282 304 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218162
AA Change: V272A

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect possibly damaging
Transcript: ENSMUST00000218342
AA Change: V272A

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000220266
Meta Mutation Damage Score 0.1018 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the sodium/bile acid cotransporter family, which are integral membrane glycoproteins that participate in the enterohepatic circulation of bile acids. Two homologous transporters are involved in the reabsorption of bile acids; the ileal sodium/bile acid cotransporter with an apical cell localization that absorbs bile acids from the intestinal lumen, bile duct and kidney, and the liver-specific sodium/bile acid cotransporter, represented by this protein, that is found in the basolateral membranes of hepatocytes. Bile acids are the catabolic product of cholesterol metabolism, hence this protein is important for cholesterol homeostasis. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A G 1: 193,174,846 I169V probably benign Het
Arrdc5 A G 17: 56,297,856 S144P probably benign Het
Astn1 A G 1: 158,667,609 M92V probably benign Het
Atg5 A G 10: 44,319,548 I189M probably damaging Het
Atmin A G 8: 116,957,538 T646A probably damaging Het
Atp1a2 G A 1: 172,287,433 R262W probably damaging Het
Atp6v1g2 A G 17: 35,236,809 K16E probably damaging Het
Bex6 G A 16: 32,186,460 E29K possibly damaging Het
Casd1 A G 6: 4,608,705 Y101C probably damaging Het
Cdx1 T C 18: 61,035,912 D70G possibly damaging Het
Cebpz T C 17: 78,935,554 T224A probably benign Het
Cep170b T C 12: 112,735,730 V319A possibly damaging Het
Chrna2 C T 14: 66,149,463 R353W possibly damaging Het
Chst5 A T 8: 111,890,544 V148E probably benign Het
Clhc1 T A 11: 29,557,771 W162R probably benign Het
Csmd1 T A 8: 16,079,978 Q1710L probably damaging Het
Ddb1 A C 19: 10,612,936 M276L probably benign Het
Dot1l C T 10: 80,785,878 R455C probably damaging Het
Dync2h1 A G 9: 7,148,735 V903A probably benign Het
Eno1b T C 18: 48,047,475 V240A possibly damaging Het
Erich1 T G 8: 14,090,527 probably benign Het
Ermp1 A C 19: 29,639,928 S227A probably benign Het
Etv1 C A 12: 38,835,116 P143Q probably null Het
Gimap8 A T 6: 48,650,568 I159F probably benign Het
Gm12666 A G 4: 92,191,656 S32P probably damaging Het
Gm8251 A C 1: 44,059,730 I736S probably benign Het
Gpr4 G A 7: 19,222,578 V142M possibly damaging Het
Gucy1a1 C T 3: 82,113,332 C86Y probably benign Het
Ifngr2 T G 16: 91,561,779 probably null Het
Insrr A T 3: 87,803,181 N398I probably damaging Het
Iws1 A G 18: 32,084,666 E441G probably damaging Het
Megf10 A T 18: 57,281,713 K732* probably null Het
Mprip T A 11: 59,749,508 probably benign Het
Mrgprb8 T C 7: 48,389,205 V208A probably benign Het
Msc G C 1: 14,755,684 P22R probably benign Het
Olfr725 A T 14: 50,034,714 S230T probably damaging Het
Opcml G A 9: 28,901,590 E193K probably damaging Het
Oxsr1 A C 9: 119,294,494 H71Q probably benign Het
Pkp2 T A 16: 16,246,967 W452R probably damaging Het
Prrc2b C T 2: 32,182,570 T20I probably damaging Het
Rasgrp3 T C 17: 75,503,141 S279P probably damaging Het
Rtl1 T A 12: 109,591,397 D1336V unknown Het
Serpina3m G T 12: 104,389,270 K65N probably benign Het
Serpine2 A G 1: 79,810,694 V182A probably damaging Het
Slc25a29 A T 12: 108,827,432 N73K probably damaging Het
Slit1 G A 19: 41,606,380 R1184W probably damaging Het
Srrm2 T C 17: 23,812,429 probably benign Het
Stk11ip A G 1: 75,525,521 probably benign Het
Tcerg1 A G 18: 42,564,145 K767R possibly damaging Het
Tmem82 T C 4: 141,616,287 K224R probably benign Het
Tmprss11g A G 5: 86,499,556 L41S probably damaging Het
Trim42 T C 9: 97,366,097 N182S probably benign Het
Ttn T C 2: 76,830,088 T7430A probably benign Het
Wwp1 T C 4: 19,650,390 T259A probably benign Het
Other mutations in Slc10a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01870:Slc10a1 APN 12 80960528 missense probably benign 0.00
IGL02065:Slc10a1 APN 12 80960474 missense possibly damaging 0.94
R0212:Slc10a1 UTSW 12 80967712 missense possibly damaging 0.62
R1170:Slc10a1 UTSW 12 80956028 missense probably damaging 1.00
R1261:Slc10a1 UTSW 12 80967830 missense probably damaging 1.00
R1832:Slc10a1 UTSW 12 80953672 missense probably benign 0.23
R2010:Slc10a1 UTSW 12 80960447 missense probably benign 0.00
R2206:Slc10a1 UTSW 12 80967628 missense probably damaging 0.99
R3905:Slc10a1 UTSW 12 80967667 missense probably damaging 0.99
R4392:Slc10a1 UTSW 12 80967804 missense probably damaging 1.00
R4413:Slc10a1 UTSW 12 80958132 missense probably benign 0.01
R5173:Slc10a1 UTSW 12 80956028 missense probably damaging 1.00
R5344:Slc10a1 UTSW 12 80953766 missense possibly damaging 0.56
R7173:Slc10a1 UTSW 12 80955976 missense probably damaging 1.00
R7253:Slc10a1 UTSW 12 80958184 missense probably benign 0.16
R7413:Slc10a1 UTSW 12 80960622 missense probably benign 0.00
R7990:Slc10a1 UTSW 12 80953780 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGCTGGCATGCTGTTTTACC -3'
(R):5'- GATCCCATCTTCCAATGCTGG -3'

Sequencing Primer
(F):5'- TTGGTAGCTCAGGTCCAGAG -3'
(R):5'- CAATGCTGGATGCTGTAGGTCTAAAG -3'
Posted On2014-09-18