Incidental Mutation 'R2094:Cep170b'
ID231989
Institutional Source Beutler Lab
Gene Symbol Cep170b
Ensembl Gene ENSMUSG00000072825
Gene Namecentrosomal protein 170B
Synonyms
MMRRC Submission 040098-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.687) question?
Stock #R2094 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location112720455-112746592 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112735730 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 319 (V319A)
Ref Sequence ENSEMBL: ENSMUSP00000152451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092279] [ENSMUST00000101018] [ENSMUST00000179041] [ENSMUST00000220627] [ENSMUST00000222711]
Predicted Effect probably benign
Transcript: ENSMUST00000092279
SMART Domains Protein: ENSMUSP00000089930
Gene: ENSMUSG00000072825

DomainStartEndE-ValueType
FHA 22 73 4.65e-10 SMART
Pfam:CEP170_C 204 598 8.9e-174 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000101018
AA Change: V319A

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000098580
Gene: ENSMUSG00000072825
AA Change: V319A

DomainStartEndE-ValueType
FHA 22 73 4.65e-10 SMART
low complexity region 370 382 N/A INTRINSIC
low complexity region 535 548 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 739 757 N/A INTRINSIC
Pfam:CEP170_C 831 1514 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000179041
AA Change: V319A

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137331
Gene: ENSMUSG00000072825
AA Change: V319A

DomainStartEndE-ValueType
FHA 22 73 4.65e-10 SMART
low complexity region 370 382 N/A INTRINSIC
low complexity region 535 548 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 739 757 N/A INTRINSIC
Pfam:CEP170_C 832 1510 4.3e-303 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183447
Predicted Effect probably benign
Transcript: ENSMUST00000220627
AA Change: V319A

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221570
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222532
Predicted Effect possibly damaging
Transcript: ENSMUST00000222711
AA Change: V319A

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223104
Meta Mutation Damage Score 0.0636 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A G 1: 193,174,846 I169V probably benign Het
Arrdc5 A G 17: 56,297,856 S144P probably benign Het
Astn1 A G 1: 158,667,609 M92V probably benign Het
Atg5 A G 10: 44,319,548 I189M probably damaging Het
Atmin A G 8: 116,957,538 T646A probably damaging Het
Atp1a2 G A 1: 172,287,433 R262W probably damaging Het
Atp6v1g2 A G 17: 35,236,809 K16E probably damaging Het
Bex6 G A 16: 32,186,460 E29K possibly damaging Het
Casd1 A G 6: 4,608,705 Y101C probably damaging Het
Cdx1 T C 18: 61,035,912 D70G possibly damaging Het
Cebpz T C 17: 78,935,554 T224A probably benign Het
Chrna2 C T 14: 66,149,463 R353W possibly damaging Het
Chst5 A T 8: 111,890,544 V148E probably benign Het
Clhc1 T A 11: 29,557,771 W162R probably benign Het
Csmd1 T A 8: 16,079,978 Q1710L probably damaging Het
Ddb1 A C 19: 10,612,936 M276L probably benign Het
Dot1l C T 10: 80,785,878 R455C probably damaging Het
Dync2h1 A G 9: 7,148,735 V903A probably benign Het
Eno1b T C 18: 48,047,475 V240A possibly damaging Het
Erich1 T G 8: 14,090,527 probably benign Het
Ermp1 A C 19: 29,639,928 S227A probably benign Het
Etv1 C A 12: 38,835,116 P143Q probably null Het
Gimap8 A T 6: 48,650,568 I159F probably benign Het
Gm12666 A G 4: 92,191,656 S32P probably damaging Het
Gm8251 A C 1: 44,059,730 I736S probably benign Het
Gpr4 G A 7: 19,222,578 V142M possibly damaging Het
Gucy1a1 C T 3: 82,113,332 C86Y probably benign Het
Ifngr2 T G 16: 91,561,779 probably null Het
Insrr A T 3: 87,803,181 N398I probably damaging Het
Iws1 A G 18: 32,084,666 E441G probably damaging Het
Megf10 A T 18: 57,281,713 K732* probably null Het
Mprip T A 11: 59,749,508 probably benign Het
Mrgprb8 T C 7: 48,389,205 V208A probably benign Het
Msc G C 1: 14,755,684 P22R probably benign Het
Olfr725 A T 14: 50,034,714 S230T probably damaging Het
Opcml G A 9: 28,901,590 E193K probably damaging Het
Oxsr1 A C 9: 119,294,494 H71Q probably benign Het
Pkp2 T A 16: 16,246,967 W452R probably damaging Het
Prrc2b C T 2: 32,182,570 T20I probably damaging Het
Rasgrp3 T C 17: 75,503,141 S279P probably damaging Het
Rtl1 T A 12: 109,591,397 D1336V unknown Het
Serpina3m G T 12: 104,389,270 K65N probably benign Het
Serpine2 A G 1: 79,810,694 V182A probably damaging Het
Slc10a1 A G 12: 80,956,048 V272A possibly damaging Het
Slc25a29 A T 12: 108,827,432 N73K probably damaging Het
Slit1 G A 19: 41,606,380 R1184W probably damaging Het
Srrm2 T C 17: 23,812,429 probably benign Het
Stk11ip A G 1: 75,525,521 probably benign Het
Tcerg1 A G 18: 42,564,145 K767R possibly damaging Het
Tmem82 T C 4: 141,616,287 K224R probably benign Het
Tmprss11g A G 5: 86,499,556 L41S probably damaging Het
Trim42 T C 9: 97,366,097 N182S probably benign Het
Ttn T C 2: 76,830,088 T7430A probably benign Het
Wwp1 T C 4: 19,650,390 T259A probably benign Het
Other mutations in Cep170b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Cep170b APN 12 112735194 missense probably damaging 1.00
IGL01313:Cep170b APN 12 112735652 missense probably damaging 1.00
IGL01317:Cep170b APN 12 112737644 missense probably damaging 1.00
IGL01660:Cep170b APN 12 112744160 missense probably damaging 1.00
IGL02032:Cep170b APN 12 112737333 critical splice donor site probably null
IGL02505:Cep170b APN 12 112743070 missense probably damaging 1.00
IGL02966:Cep170b APN 12 112736444 missense possibly damaging 0.75
IGL03111:Cep170b APN 12 112735179 missense probably damaging 1.00
IGL03367:Cep170b APN 12 112737238 missense probably benign 0.00
R0348:Cep170b UTSW 12 112736806 missense probably damaging 1.00
R0562:Cep170b UTSW 12 112739189 missense probably benign 0.00
R0909:Cep170b UTSW 12 112732039 missense probably null 0.06
R1217:Cep170b UTSW 12 112740905 missense probably damaging 0.99
R1300:Cep170b UTSW 12 112737257 missense probably benign 0.02
R1647:Cep170b UTSW 12 112736372 missense probably damaging 1.00
R1648:Cep170b UTSW 12 112736372 missense probably damaging 1.00
R1652:Cep170b UTSW 12 112733513 missense probably damaging 0.99
R1737:Cep170b UTSW 12 112736627 missense possibly damaging 0.71
R1936:Cep170b UTSW 12 112735738 missense probably damaging 1.00
R1962:Cep170b UTSW 12 112738061 missense probably damaging 1.00
R2208:Cep170b UTSW 12 112738985 missense probably benign 0.00
R3418:Cep170b UTSW 12 112738468 nonsense probably null
R3735:Cep170b UTSW 12 112741004 missense probably damaging 1.00
R3736:Cep170b UTSW 12 112741004 missense probably damaging 1.00
R4299:Cep170b UTSW 12 112739305 missense probably damaging 1.00
R4577:Cep170b UTSW 12 112744718 missense probably damaging 1.00
R5199:Cep170b UTSW 12 112744147 missense probably damaging 1.00
R5512:Cep170b UTSW 12 112733485 missense possibly damaging 0.86
R5575:Cep170b UTSW 12 112735632 missense probably damaging 1.00
R5643:Cep170b UTSW 12 112740841 missense probably benign 0.35
R6074:Cep170b UTSW 12 112744155 missense probably damaging 1.00
R6265:Cep170b UTSW 12 112744559 missense probably damaging 1.00
R6371:Cep170b UTSW 12 112740945 missense probably damaging 1.00
R6376:Cep170b UTSW 12 112732068 missense probably damaging 0.99
R7055:Cep170b UTSW 12 112735715 missense probably damaging 1.00
R7137:Cep170b UTSW 12 112735167 missense probably benign
R7226:Cep170b UTSW 12 112737925 missense possibly damaging 0.80
R7615:Cep170b UTSW 12 112744665 missense probably damaging 1.00
R7831:Cep170b UTSW 12 112744800 missense probably benign 0.08
R7914:Cep170b UTSW 12 112744800 missense probably benign 0.08
Z1176:Cep170b UTSW 12 112741012 critical splice donor site unknown
Predicted Primers PCR Primer
(F):5'- ACTTTGAGATCCCCACGAAGG -3'
(R):5'- AGTCCTGGCCAATTCACTGG -3'

Sequencing Primer
(F):5'- TGCCTACCCAGGAAGTGC -3'
(R):5'- TCACTGGGAAGTGAAAACTAGCC -3'
Posted On2014-09-18