Incidental Mutation 'R2094:Pkp2'
ID231996
Institutional Source Beutler Lab
Gene Symbol Pkp2
Ensembl Gene ENSMUSG00000041957
Gene Nameplakophilin 2
Synonyms1200008D14Rik, Pkp2l, 1200012P04Rik
MMRRC Submission 040098-MU
Accession Numbers

NCBI RefSeq: NM_026163.2; MGI: 1914701

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2094 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location16213318-16272712 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 16246967 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 452 (W452R)
Ref Sequence ENSEMBL: ENSMUSP00000036890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039408] [ENSMUST00000161342]
Predicted Effect probably damaging
Transcript: ENSMUST00000039408
AA Change: W452R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036890
Gene: ENSMUSG00000041957
AA Change: W452R

DomainStartEndE-ValueType
low complexity region 258 271 N/A INTRINSIC
ARM 342 382 7.5e-9 SMART
ARM 384 425 5.14e-7 SMART
Blast:ARM 426 481 2e-29 BLAST
ARM 484 530 8.76e-1 SMART
ARM 631 672 2.98e-3 SMART
Blast:ARM 677 718 2e-11 BLAST
Blast:ARM 720 763 5e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161342
SMART Domains Protein: ENSMUSP00000125219
Gene: ENSMUSG00000041957

DomainStartEndE-ValueType
low complexity region 258 271 N/A INTRINSIC
Pfam:Arm 342 382 3.5e-10 PFAM
Pfam:Arm 384 425 4.7e-9 PFAM
Blast:ARM 426 477 5e-27 BLAST
Meta Mutation Damage Score 0.8837 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (56/56)
MGI Phenotype Strain: 3487374
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the arm-repeat (armadillo) and plakophilin gene families. Plakophilin proteins contain numerous armadillo repeats, localize to cell desmosomes and nuclei, and participate in linking cadherins to intermediate filaments in the cytoskeleton. This gene product may regulate the signaling activity of beta-catenin. Two alternately spliced transcripts encoding two protein isoforms have been identified. A processed pseudogene with high similarity to this locus has been mapped to chromosome 12p13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality with impaired heart formation, hemopericardium, and hemoperitoneum. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(2) Gene trapped(4)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A G 1: 193,174,846 I169V probably benign Het
Arrdc5 A G 17: 56,297,856 S144P probably benign Het
Astn1 A G 1: 158,667,609 M92V probably benign Het
Atg5 A G 10: 44,319,548 I189M probably damaging Het
Atmin A G 8: 116,957,538 T646A probably damaging Het
Atp1a2 G A 1: 172,287,433 R262W probably damaging Het
Atp6v1g2 A G 17: 35,236,809 K16E probably damaging Het
Bex6 G A 16: 32,186,460 E29K possibly damaging Het
Casd1 A G 6: 4,608,705 Y101C probably damaging Het
Cdx1 T C 18: 61,035,912 D70G possibly damaging Het
Cebpz T C 17: 78,935,554 T224A probably benign Het
Cep170b T C 12: 112,735,730 V319A possibly damaging Het
Chrna2 C T 14: 66,149,463 R353W possibly damaging Het
Chst5 A T 8: 111,890,544 V148E probably benign Het
Clhc1 T A 11: 29,557,771 W162R probably benign Het
Csmd1 T A 8: 16,079,978 Q1710L probably damaging Het
Ddb1 A C 19: 10,612,936 M276L probably benign Het
Dot1l C T 10: 80,785,878 R455C probably damaging Het
Dync2h1 A G 9: 7,148,735 V903A probably benign Het
Eno1b T C 18: 48,047,475 V240A possibly damaging Het
Erich1 T G 8: 14,090,527 probably benign Het
Ermp1 A C 19: 29,639,928 S227A probably benign Het
Etv1 C A 12: 38,835,116 P143Q probably null Het
Gimap8 A T 6: 48,650,568 I159F probably benign Het
Gm12666 A G 4: 92,191,656 S32P probably damaging Het
Gm8251 A C 1: 44,059,730 I736S probably benign Het
Gpr4 G A 7: 19,222,578 V142M possibly damaging Het
Gucy1a1 C T 3: 82,113,332 C86Y probably benign Het
Ifngr2 T G 16: 91,561,779 probably null Het
Insrr A T 3: 87,803,181 N398I probably damaging Het
Iws1 A G 18: 32,084,666 E441G probably damaging Het
Megf10 A T 18: 57,281,713 K732* probably null Het
Mprip T A 11: 59,749,508 probably benign Het
Mrgprb8 T C 7: 48,389,205 V208A probably benign Het
Msc G C 1: 14,755,684 P22R probably benign Het
Olfr725 A T 14: 50,034,714 S230T probably damaging Het
Opcml G A 9: 28,901,590 E193K probably damaging Het
Oxsr1 A C 9: 119,294,494 H71Q probably benign Het
Prrc2b C T 2: 32,182,570 T20I probably damaging Het
Rasgrp3 T C 17: 75,503,141 S279P probably damaging Het
Rtl1 T A 12: 109,591,397 D1336V unknown Het
Serpina3m G T 12: 104,389,270 K65N probably benign Het
Serpine2 A G 1: 79,810,694 V182A probably damaging Het
Slc10a1 A G 12: 80,956,048 V272A possibly damaging Het
Slc25a29 A T 12: 108,827,432 N73K probably damaging Het
Slit1 G A 19: 41,606,380 R1184W probably damaging Het
Srrm2 T C 17: 23,812,429 probably benign Het
Stk11ip A G 1: 75,525,521 probably benign Het
Tcerg1 A G 18: 42,564,145 K767R possibly damaging Het
Tmem82 T C 4: 141,616,287 K224R probably benign Het
Tmprss11g A G 5: 86,499,556 L41S probably damaging Het
Trim42 T C 9: 97,366,097 N182S probably benign Het
Ttn T C 2: 76,830,088 T7430A probably benign Het
Wwp1 T C 4: 19,650,390 T259A probably benign Het
Other mutations in Pkp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
P0014:Pkp2 UTSW 16 16240522 missense probably benign 0.08
R0131:Pkp2 UTSW 16 16240713 splice site probably benign
R0581:Pkp2 UTSW 16 16269783 splice site probably benign
R0722:Pkp2 UTSW 16 16247028 missense probably benign
R0882:Pkp2 UTSW 16 16269711 missense probably damaging 1.00
R0942:Pkp2 UTSW 16 16226030 missense probably benign
R1236:Pkp2 UTSW 16 16225902 missense probably benign
R1265:Pkp2 UTSW 16 16225304 missense probably benign 0.00
R1674:Pkp2 UTSW 16 16240558 missense possibly damaging 0.50
R1687:Pkp2 UTSW 16 16268709 critical splice donor site probably null
R1769:Pkp2 UTSW 16 16262697 missense probably damaging 1.00
R4360:Pkp2 UTSW 16 16268682 missense probably benign 0.03
R4739:Pkp2 UTSW 16 16230724 missense probably damaging 0.99
R5162:Pkp2 UTSW 16 16260336 missense probably damaging 1.00
R5607:Pkp2 UTSW 16 16260375 missense probably damaging 0.98
R6334:Pkp2 UTSW 16 16226069 missense probably damaging 0.99
R6918:Pkp2 UTSW 16 16272218 missense probably damaging 1.00
R7274:Pkp2 UTSW 16 16246929 missense possibly damaging 0.92
R7408:Pkp2 UTSW 16 16261673 missense possibly damaging 0.50
R7698:Pkp2 UTSW 16 16240659 missense probably benign 0.01
R7788:Pkp2 UTSW 16 16225408 missense probably benign 0.01
R8030:Pkp2 UTSW 16 16246910 missense probably benign
R8056:Pkp2 UTSW 16 16213400 missense probably benign 0.28
R8161:Pkp2 UTSW 16 16213449 missense probably damaging 0.99
R8253:Pkp2 UTSW 16 16268542 missense probably damaging 1.00
R8681:Pkp2 UTSW 16 16230681 missense probably benign
Z1176:Pkp2 UTSW 16 16230700 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTTCACAGTCTTGAAGTTGATGGC -3'
(R):5'- TGCCATCAGTTTCTACCCAAGC -3'

Sequencing Primer
(F):5'- GCCTTGCCTTGAGTTTGAGCAC -3'
(R):5'- TCAGTTTCTACCCAAGCAGAGTC -3'
Posted On2014-09-18