Incidental Mutation 'R2094:Atp6v1g2'
ID232000
Institutional Source Beutler Lab
Gene Symbol Atp6v1g2
Ensembl Gene ENSMUSG00000024403
Gene NameATPase, H+ transporting, lysosomal V1 subunit G2
SynonymsNG38, Atp6g2, lysosomal 13kDa, 1500002D01Rik, VAG2
MMRRC Submission 040098-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2094 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location35233660-35238767 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35236809 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 16 (K16E)
Ref Sequence ENSEMBL: ENSMUSP00000069482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048994] [ENSMUST00000068056] [ENSMUST00000068261] [ENSMUST00000118384] [ENSMUST00000130992] [ENSMUST00000174757]
Predicted Effect probably benign
Transcript: ENSMUST00000048994
SMART Domains Protein: ENSMUSP00000035452
Gene: ENSMUSG00000042419

DomainStartEndE-ValueType
low complexity region 30 40 N/A INTRINSIC
ANK 65 94 1.01e2 SMART
ANK 98 131 3.81e2 SMART
low complexity region 153 165 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068056
SMART Domains Protein: ENSMUSP00000070682
Gene: ENSMUSG00000019432

DomainStartEndE-ValueType
DEXDc 64 265 7.17e-55 SMART
HELICc 301 382 1.48e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000068261
AA Change: K16E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069482
Gene: ENSMUSG00000024403
AA Change: K16E

DomainStartEndE-ValueType
Pfam:V-ATPase_G 3 107 3e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118384
SMART Domains Protein: ENSMUSP00000113511
Gene: ENSMUSG00000024403

DomainStartEndE-ValueType
Pfam:V-ATPase_G 1 82 1.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130992
SMART Domains Protein: ENSMUSP00000134733
Gene: ENSMUSG00000024403

DomainStartEndE-ValueType
Pfam:V-ATPase_G 1 66 8.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142415
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143289
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146711
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174164
Predicted Effect probably benign
Transcript: ENSMUST00000174757
SMART Domains Protein: ENSMUSP00000133705
Gene: ENSMUSG00000019432

DomainStartEndE-ValueType
DEXDc 1 147 2.85e-17 SMART
Meta Mutation Damage Score 0.4406 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of intracellular compartments of eukaryotic cells. V-ATPase dependent acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This encoded protein is one of three V1 domain G subunit proteins. This gene had previous gene symbols of ATP6G and ATP6G2. Alternatively spliced transcript variants encoding different isoforms have been described. Read-through transcription also exists between this gene and the downstream DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B (DDX39B) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are produced in the expected ratio. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A G 1: 193,174,846 I169V probably benign Het
Arrdc5 A G 17: 56,297,856 S144P probably benign Het
Astn1 A G 1: 158,667,609 M92V probably benign Het
Atg5 A G 10: 44,319,548 I189M probably damaging Het
Atmin A G 8: 116,957,538 T646A probably damaging Het
Atp1a2 G A 1: 172,287,433 R262W probably damaging Het
Bex6 G A 16: 32,186,460 E29K possibly damaging Het
Casd1 A G 6: 4,608,705 Y101C probably damaging Het
Cdx1 T C 18: 61,035,912 D70G possibly damaging Het
Cebpz T C 17: 78,935,554 T224A probably benign Het
Cep170b T C 12: 112,735,730 V319A possibly damaging Het
Chrna2 C T 14: 66,149,463 R353W possibly damaging Het
Chst5 A T 8: 111,890,544 V148E probably benign Het
Clhc1 T A 11: 29,557,771 W162R probably benign Het
Csmd1 T A 8: 16,079,978 Q1710L probably damaging Het
Ddb1 A C 19: 10,612,936 M276L probably benign Het
Dot1l C T 10: 80,785,878 R455C probably damaging Het
Dync2h1 A G 9: 7,148,735 V903A probably benign Het
Eno1b T C 18: 48,047,475 V240A possibly damaging Het
Erich1 T G 8: 14,090,527 probably benign Het
Ermp1 A C 19: 29,639,928 S227A probably benign Het
Etv1 C A 12: 38,835,116 P143Q probably null Het
Gimap8 A T 6: 48,650,568 I159F probably benign Het
Gm12666 A G 4: 92,191,656 S32P probably damaging Het
Gm8251 A C 1: 44,059,730 I736S probably benign Het
Gpr4 G A 7: 19,222,578 V142M possibly damaging Het
Gucy1a1 C T 3: 82,113,332 C86Y probably benign Het
Ifngr2 T G 16: 91,561,779 probably null Het
Insrr A T 3: 87,803,181 N398I probably damaging Het
Iws1 A G 18: 32,084,666 E441G probably damaging Het
Megf10 A T 18: 57,281,713 K732* probably null Het
Mprip T A 11: 59,749,508 probably benign Het
Mrgprb8 T C 7: 48,389,205 V208A probably benign Het
Msc G C 1: 14,755,684 P22R probably benign Het
Olfr725 A T 14: 50,034,714 S230T probably damaging Het
Opcml G A 9: 28,901,590 E193K probably damaging Het
Oxsr1 A C 9: 119,294,494 H71Q probably benign Het
Pkp2 T A 16: 16,246,967 W452R probably damaging Het
Prrc2b C T 2: 32,182,570 T20I probably damaging Het
Rasgrp3 T C 17: 75,503,141 S279P probably damaging Het
Rtl1 T A 12: 109,591,397 D1336V unknown Het
Serpina3m G T 12: 104,389,270 K65N probably benign Het
Serpine2 A G 1: 79,810,694 V182A probably damaging Het
Slc10a1 A G 12: 80,956,048 V272A possibly damaging Het
Slc25a29 A T 12: 108,827,432 N73K probably damaging Het
Slit1 G A 19: 41,606,380 R1184W probably damaging Het
Srrm2 T C 17: 23,812,429 probably benign Het
Stk11ip A G 1: 75,525,521 probably benign Het
Tcerg1 A G 18: 42,564,145 K767R possibly damaging Het
Tmem82 T C 4: 141,616,287 K224R probably benign Het
Tmprss11g A G 5: 86,499,556 L41S probably damaging Het
Trim42 T C 9: 97,366,097 N182S probably benign Het
Ttn T C 2: 76,830,088 T7430A probably benign Het
Wwp1 T C 4: 19,650,390 T259A probably benign Het
Other mutations in Atp6v1g2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2360:Atp6v1g2 UTSW 17 35237662 missense probably damaging 1.00
R2497:Atp6v1g2 UTSW 17 35236786 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGAGGATGACAGACACCC -3'
(R):5'- GACTGTAAAACCCACCCGTTTC -3'

Sequencing Primer
(F):5'- CTGAGTGAAAACGGGAGCGC -3'
(R):5'- GTAAAACCCACCCGTTTCTTCTAC -3'
Posted On2014-09-18