Mutagenetix > Incidental Mutations

Incidental Mutation 'R2094:Cebpz'

232003

Institutional Source

Beutler Lab

Gene Symbol

Cebpz

Ensembl Gene

ENSMUSG00000024081

Gene Name

CCAAT/enhancer binding protein zeta

Synonyms

Cebpa-rs1, Cbf, CBF2

MMRRC Submission

040098-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.971) question?

Stock #

R2094 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

78919006-78937070 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 78935554 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 224 (T224A)

Ref Sequence

ENSEMBL: ENSMUSP00000024885 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024885] [ENSMUST00000024887]

Predicted Effect

probably benign
Transcript: ENSMUST00000024885
AA Change: T224A

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000024885
Gene: ENSMUSG00000024081
AA Change: T224A

Domain	Start	End	E-Value	Type
low complexity region	23	36	N/A	INTRINSIC
coiled coil region	113	143	N/A	INTRINSIC
Pfam:CBF	523	732	5.7e-58	PFAM
low complexity region	834	851	N/A	INTRINSIC
low complexity region	881	904	N/A	INTRINSIC
low complexity region	957	969	N/A	INTRINSIC
low complexity region	1028	1042	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000024887

SMART Domains

Protein: ENSMUSP00000024887
Gene: ENSMUSG00000024082

Domain	Start	End	E-Value	Type
Pfam:Methyltransf_28	95	349	5.5e-75	PFAM

Meta Mutation Damage Score

0.0599

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the CEBP family. The encoded protein plays a role in cellular response to environmental stimuli through a transcriptional process that involves heat shock factors, conserved DNA elements (heat shock elements or HSEs) and CCAAT boxes. The protein acts as a DNA-binding transcriptional activator and regulates the heat-shock protein 70 (HSP70) promoter in a CCAAT-dependent manner. The protein is also involved in cell growth and differentiation, particularly, hematopoietic differentiation. Methylation of the promoter of this gene or mutations within the gene may be correlated with occurance of acute myeloid leukemia (AML). [provided by RefSeq, Jun 2016]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A130010J15Rik	A	G	1: 193,174,846	I169V	probably benign	Het
Arrdc5	A	G	17: 56,297,856	S144P	probably benign	Het
Astn1	A	G	1: 158,667,609	M92V	probably benign	Het
Atg5	A	G	10: 44,319,548	I189M	probably damaging	Het
Atmin	A	G	8: 116,957,538	T646A	probably damaging	Het
Atp1a2	G	A	1: 172,287,433	R262W	probably damaging	Het
Atp6v1g2	A	G	17: 35,236,809	K16E	probably damaging	Het
Bex6	G	A	16: 32,186,460	E29K	possibly damaging	Het
Casd1	A	G	6: 4,608,705	Y101C	probably damaging	Het
Cdx1	T	C	18: 61,035,912	D70G	possibly damaging	Het
Cep170b	T	C	12: 112,735,730	V319A	possibly damaging	Het
Chrna2	C	T	14: 66,149,463	R353W	possibly damaging	Het
Chst5	A	T	8: 111,890,544	V148E	probably benign	Het
Clhc1	T	A	11: 29,557,771	W162R	probably benign	Het
Csmd1	T	A	8: 16,079,978	Q1710L	probably damaging	Het
Ddb1	A	C	19: 10,612,936	M276L	probably benign	Het
Dot1l	C	T	10: 80,785,878	R455C	probably damaging	Het
Dync2h1	A	G	9: 7,148,735	V903A	probably benign	Het
Eno1b	T	C	18: 48,047,475	V240A	possibly damaging	Het
Erich1	T	G	8: 14,090,527		probably benign	Het
Ermp1	A	C	19: 29,639,928	S227A	probably benign	Het
Etv1	C	A	12: 38,835,116	P143Q	probably null	Het
Gimap8	A	T	6: 48,650,568	I159F	probably benign	Het
Gm12666	A	G	4: 92,191,656	S32P	probably damaging	Het
Gm8251	A	C	1: 44,059,730	I736S	probably benign	Het
Gpr4	G	A	7: 19,222,578	V142M	possibly damaging	Het
Gucy1a1	C	T	3: 82,113,332	C86Y	probably benign	Het
Ifngr2	T	G	16: 91,561,779		probably null	Het
Insrr	A	T	3: 87,803,181	N398I	probably damaging	Het
Iws1	A	G	18: 32,084,666	E441G	probably damaging	Het
Megf10	A	T	18: 57,281,713	K732*	probably null	Het
Mprip	T	A	11: 59,749,508		probably benign	Het
Mrgprb8	T	C	7: 48,389,205	V208A	probably benign	Het
Msc	G	C	1: 14,755,684	P22R	probably benign	Het
Olfr725	A	T	14: 50,034,714	S230T	probably damaging	Het
Opcml	G	A	9: 28,901,590	E193K	probably damaging	Het
Oxsr1	A	C	9: 119,294,494	H71Q	probably benign	Het
Pkp2	T	A	16: 16,246,967	W452R	probably damaging	Het
Prrc2b	C	T	2: 32,182,570	T20I	probably damaging	Het
Rasgrp3	T	C	17: 75,503,141	S279P	probably damaging	Het
Rtl1	T	A	12: 109,591,397	D1336V	unknown	Het
Serpina3m	G	T	12: 104,389,270	K65N	probably benign	Het
Serpine2	A	G	1: 79,810,694	V182A	probably damaging	Het
Slc10a1	A	G	12: 80,956,048	V272A	possibly damaging	Het
Slc25a29	A	T	12: 108,827,432	N73K	probably damaging	Het
Slit1	G	A	19: 41,606,380	R1184W	probably damaging	Het
Srrm2	T	C	17: 23,812,429		probably benign	Het
Stk11ip	A	G	1: 75,525,521		probably benign	Het
Tcerg1	A	G	18: 42,564,145	K767R	possibly damaging	Het
Tmem82	T	C	4: 141,616,287	K224R	probably benign	Het
Tmprss11g	A	G	5: 86,499,556	L41S	probably damaging	Het
Trim42	T	C	9: 97,366,097	N182S	probably benign	Het
Ttn	T	C	2: 76,830,088	T7430A	probably benign	Het
Wwp1	T	C	4: 19,650,390	T259A	probably benign	Het

Other mutations in Cebpz

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00817:Cebpz	APN	17	78934830	missense	probably damaging	1.00
IGL01558:Cebpz	APN	17	78935305	missense	probably damaging	1.00
IGL01724:Cebpz	APN	17	78935913	missense	probably benign	0.01
IGL01938:Cebpz	APN	17	78934961	nonsense	probably null
IGL02165:Cebpz	APN	17	78922169	missense	probably damaging	1.00
IGL02397:Cebpz	APN	17	78923261	missense	possibly damaging	0.63
IGL02455:Cebpz	APN	17	78935036	missense	probably benign	0.16
IGL02690:Cebpz	APN	17	78922557	missense	probably damaging	1.00
IGL02698:Cebpz	APN	17	78935574	missense	probably benign	0.03
IGL02755:Cebpz	APN	17	78931330	missense	probably damaging	1.00
IGL02827:Cebpz	APN	17	78929331	missense	probably damaging	1.00
IGL03149:Cebpz	APN	17	78922553	missense	probably benign	0.01
cedar_hill	UTSW	17	78936910	missense	possibly damaging	0.87
R0125:Cebpz	UTSW	17	78919888	missense	possibly damaging	0.95
R0138:Cebpz	UTSW	17	78931391	missense	probably benign
R0310:Cebpz	UTSW	17	78926124	missense	probably damaging	1.00
R0436:Cebpz	UTSW	17	78935650	missense	probably benign	0.00
R0589:Cebpz	UTSW	17	78936879	missense	probably damaging	1.00
R0828:Cebpz	UTSW	17	78925982	missense	probably benign	0.04
R1355:Cebpz	UTSW	17	78935324	missense	probably benign	0.01
R1367:Cebpz	UTSW	17	78923313	missense	probably benign
R1583:Cebpz	UTSW	17	78934752	missense	probably damaging	1.00
R1639:Cebpz	UTSW	17	78934606	missense	possibly damaging	0.49
R1818:Cebpz	UTSW	17	78935376	missense	probably damaging	1.00
R1885:Cebpz	UTSW	17	78932116	missense	probably benign	0.00
R1908:Cebpz	UTSW	17	78934907	nonsense	probably null
R1909:Cebpz	UTSW	17	78934907	nonsense	probably null
R2314:Cebpz	UTSW	17	78920547	critical splice donor site	probably null
R2763:Cebpz	UTSW	17	78935929	missense	probably benign
R2874:Cebpz	UTSW	17	78932103	splice site	probably benign
R3807:Cebpz	UTSW	17	78935418	missense	probably damaging	1.00
R4012:Cebpz	UTSW	17	78924467	missense	probably damaging	0.98
R5344:Cebpz	UTSW	17	78926113	missense	possibly damaging	0.82
R5394:Cebpz	UTSW	17	78922205	missense	probably benign	0.34
R5711:Cebpz	UTSW	17	78934611	missense	probably damaging	1.00
R5902:Cebpz	UTSW	17	78925937	missense	probably benign	0.20
R6238:Cebpz	UTSW	17	78936910	missense	possibly damaging	0.87
R6257:Cebpz	UTSW	17	78935832	missense	probably benign	0.17
R6825:Cebpz	UTSW	17	78919963	missense	probably damaging	1.00
R7735:Cebpz	UTSW	17	78925913	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- AGGTCTGTGATGAGCAACTCC -3'
(R):5'- CCCGATGTGTTTGAATTTCTAGAGAG -3'

Sequencing Primer
(F):5'- TGAGCAACTCCTTGAACGTG -3'
(R):5'- GACAAACAATGTTACTCAGGCCTGG -3'

Posted On

2014-09-18