Incidental Mutation 'R2094:Iws1'
ID232004
Institutional Source Beutler Lab
Gene Symbol Iws1
Ensembl Gene ENSMUSG00000024384
Gene NameIWS1, SUPT6 interacting protein
Synonyms1700069O15Rik
MMRRC Submission 040098-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R2094 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location32067741-32104328 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32084666 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 441 (E441G)
Ref Sequence ENSEMBL: ENSMUSP00000148514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025243] [ENSMUST00000212675]
Predicted Effect probably damaging
Transcript: ENSMUST00000025243
AA Change: E441G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025243
Gene: ENSMUSG00000024384
AA Change: E441G

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
low complexity region 73 86 N/A INTRINSIC
low complexity region 92 109 N/A INTRINSIC
internal_repeat_2 112 179 9.21e-13 PROSPERO
internal_repeat_1 118 184 9.82e-20 PROSPERO
internal_repeat_1 183 296 9.82e-20 PROSPERO
internal_repeat_2 229 316 9.21e-13 PROSPERO
low complexity region 320 332 N/A INTRINSIC
low complexity region 357 373 N/A INTRINSIC
low complexity region 384 404 N/A INTRINSIC
low complexity region 407 418 N/A INTRINSIC
low complexity region 422 442 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
Pfam:Med26 584 636 4.8e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212115
Predicted Effect probably benign
Transcript: ENSMUST00000212280
Predicted Effect probably benign
Transcript: ENSMUST00000212458
Predicted Effect probably damaging
Transcript: ENSMUST00000212675
AA Change: E441G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000213074
Meta Mutation Damage Score 0.1247 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A G 1: 193,174,846 I169V probably benign Het
Arrdc5 A G 17: 56,297,856 S144P probably benign Het
Astn1 A G 1: 158,667,609 M92V probably benign Het
Atg5 A G 10: 44,319,548 I189M probably damaging Het
Atmin A G 8: 116,957,538 T646A probably damaging Het
Atp1a2 G A 1: 172,287,433 R262W probably damaging Het
Atp6v1g2 A G 17: 35,236,809 K16E probably damaging Het
Bex6 G A 16: 32,186,460 E29K possibly damaging Het
Casd1 A G 6: 4,608,705 Y101C probably damaging Het
Cdx1 T C 18: 61,035,912 D70G possibly damaging Het
Cebpz T C 17: 78,935,554 T224A probably benign Het
Cep170b T C 12: 112,735,730 V319A possibly damaging Het
Chrna2 C T 14: 66,149,463 R353W possibly damaging Het
Chst5 A T 8: 111,890,544 V148E probably benign Het
Clhc1 T A 11: 29,557,771 W162R probably benign Het
Csmd1 T A 8: 16,079,978 Q1710L probably damaging Het
Ddb1 A C 19: 10,612,936 M276L probably benign Het
Dot1l C T 10: 80,785,878 R455C probably damaging Het
Dync2h1 A G 9: 7,148,735 V903A probably benign Het
Eno1b T C 18: 48,047,475 V240A possibly damaging Het
Erich1 T G 8: 14,090,527 probably benign Het
Ermp1 A C 19: 29,639,928 S227A probably benign Het
Etv1 C A 12: 38,835,116 P143Q probably null Het
Gimap8 A T 6: 48,650,568 I159F probably benign Het
Gm12666 A G 4: 92,191,656 S32P probably damaging Het
Gm8251 A C 1: 44,059,730 I736S probably benign Het
Gpr4 G A 7: 19,222,578 V142M possibly damaging Het
Gucy1a1 C T 3: 82,113,332 C86Y probably benign Het
Ifngr2 T G 16: 91,561,779 probably null Het
Insrr A T 3: 87,803,181 N398I probably damaging Het
Megf10 A T 18: 57,281,713 K732* probably null Het
Mprip T A 11: 59,749,508 probably benign Het
Mrgprb8 T C 7: 48,389,205 V208A probably benign Het
Msc G C 1: 14,755,684 P22R probably benign Het
Olfr725 A T 14: 50,034,714 S230T probably damaging Het
Opcml G A 9: 28,901,590 E193K probably damaging Het
Oxsr1 A C 9: 119,294,494 H71Q probably benign Het
Pkp2 T A 16: 16,246,967 W452R probably damaging Het
Prrc2b C T 2: 32,182,570 T20I probably damaging Het
Rasgrp3 T C 17: 75,503,141 S279P probably damaging Het
Rtl1 T A 12: 109,591,397 D1336V unknown Het
Serpina3m G T 12: 104,389,270 K65N probably benign Het
Serpine2 A G 1: 79,810,694 V182A probably damaging Het
Slc10a1 A G 12: 80,956,048 V272A possibly damaging Het
Slc25a29 A T 12: 108,827,432 N73K probably damaging Het
Slit1 G A 19: 41,606,380 R1184W probably damaging Het
Srrm2 T C 17: 23,812,429 probably benign Het
Stk11ip A G 1: 75,525,521 probably benign Het
Tcerg1 A G 18: 42,564,145 K767R possibly damaging Het
Tmem82 T C 4: 141,616,287 K224R probably benign Het
Tmprss11g A G 5: 86,499,556 L41S probably damaging Het
Trim42 T C 9: 97,366,097 N182S probably benign Het
Ttn T C 2: 76,830,088 T7430A probably benign Het
Wwp1 T C 4: 19,650,390 T259A probably benign Het
Other mutations in Iws1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Iws1 APN 18 32084688 missense probably benign 0.07
IGL01432:Iws1 APN 18 32083466 splice site probably benign
IGL01647:Iws1 APN 18 32097222 nonsense probably null
IGL02054:Iws1 APN 18 32090542 critical splice donor site probably null
IGL02189:Iws1 APN 18 32093125 missense probably damaging 1.00
IGL02664:Iws1 APN 18 32070164 missense possibly damaging 0.81
IGL03384:Iws1 APN 18 32093150 missense probably damaging 1.00
IGL03394:Iws1 APN 18 32088248 splice site probably benign
R0352:Iws1 UTSW 18 32084205 missense probably damaging 1.00
R1385:Iws1 UTSW 18 32090430 missense probably benign 0.03
R1486:Iws1 UTSW 18 32097256 missense probably damaging 1.00
R1526:Iws1 UTSW 18 32080125 missense probably benign 0.00
R1529:Iws1 UTSW 18 32080281 missense probably benign
R3774:Iws1 UTSW 18 32079995 missense probably damaging 1.00
R3907:Iws1 UTSW 18 32079920 missense possibly damaging 0.93
R4018:Iws1 UTSW 18 32070152 nonsense probably null
R4423:Iws1 UTSW 18 32083450 missense probably damaging 1.00
R4703:Iws1 UTSW 18 32080013 missense probably benign 0.19
R4979:Iws1 UTSW 18 32093267 unclassified probably benign
R5228:Iws1 UTSW 18 32088261 missense probably damaging 1.00
R5352:Iws1 UTSW 18 32083404 missense probably damaging 1.00
R6428:Iws1 UTSW 18 32086290 missense probably damaging 1.00
R6846:Iws1 UTSW 18 32086273 unclassified probably benign
R6892:Iws1 UTSW 18 32086274 missense probably damaging 0.99
R7163:Iws1 UTSW 18 32093224 missense possibly damaging 0.80
R7540:Iws1 UTSW 18 32080483 missense possibly damaging 0.94
R7605:Iws1 UTSW 18 32089487 missense probably benign 0.01
R7714:Iws1 UTSW 18 32090515 missense probably benign 0.00
R8218:Iws1 UTSW 18 32093635 missense probably benign 0.00
R8229:Iws1 UTSW 18 32084687 missense probably benign
R8728:Iws1 UTSW 18 32083281 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCATGAACGTGCTCATACAGG -3'
(R):5'- ACTCTTCCCAATCTGGAGCC -3'

Sequencing Primer
(F):5'- CGTGCTCATACAGGTATGGAC -3'
(R):5'- TGGAGCCCCAGATGAGAAAC -3'
Posted On2014-09-18