Incidental Mutation 'R2094:Ermp1'
ID232009
Institutional Source Beutler Lab
Gene Symbol Ermp1
Ensembl Gene ENSMUSG00000046324
Gene Nameendoplasmic reticulum metallopeptidase 1
SynonymsD19Ertd410e, D19Wsu12e
MMRRC Submission 040098-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2094 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location29608214-29648415 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 29639928 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 227 (S227A)
Ref Sequence ENSEMBL: ENSMUSP00000124881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054083] [ENSMUST00000159692] [ENSMUST00000162534]
Predicted Effect probably benign
Transcript: ENSMUST00000054083
SMART Domains Protein: ENSMUSP00000057069
Gene: ENSMUSG00000046324

DomainStartEndE-ValueType
SCOP:d1amp__ 31 159 3e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159243
Predicted Effect probably benign
Transcript: ENSMUST00000159692
AA Change: S227A

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000124881
Gene: ENSMUSG00000046324
AA Change: S227A

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 65 94 N/A INTRINSIC
Pfam:Peptidase_M28 179 373 1.3e-49 PFAM
Pfam:Peptidase_M20 184 375 2.9e-8 PFAM
transmembrane domain 405 427 N/A INTRINSIC
transmembrane domain 444 466 N/A INTRINSIC
transmembrane domain 481 503 N/A INTRINSIC
transmembrane domain 516 538 N/A INTRINSIC
transmembrane domain 543 562 N/A INTRINSIC
transmembrane domain 575 597 N/A INTRINSIC
transmembrane domain 617 639 N/A INTRINSIC
transmembrane domain 646 668 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161124
Predicted Effect probably benign
Transcript: ENSMUST00000162534
AA Change: S40A

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000124992
Gene: ENSMUSG00000046324
AA Change: S40A

DomainStartEndE-ValueType
Pfam:Peptidase_M28 5 176 2.4e-40 PFAM
Pfam:Peptidase_M20 8 168 1.3e-8 PFAM
transmembrane domain 218 240 N/A INTRINSIC
transmembrane domain 257 279 N/A INTRINSIC
transmembrane domain 294 316 N/A INTRINSIC
transmembrane domain 329 351 N/A INTRINSIC
transmembrane domain 356 375 N/A INTRINSIC
Meta Mutation Damage Score 0.0632 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects including double outlet right ventricle, aortic arch anomalies and vascular ring, as well as anopthalmia, renal dysplasia, and craniofacial anomalies including short snout, cleft palate and cleft lip. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A G 1: 193,174,846 I169V probably benign Het
Arrdc5 A G 17: 56,297,856 S144P probably benign Het
Astn1 A G 1: 158,667,609 M92V probably benign Het
Atg5 A G 10: 44,319,548 I189M probably damaging Het
Atmin A G 8: 116,957,538 T646A probably damaging Het
Atp1a2 G A 1: 172,287,433 R262W probably damaging Het
Atp6v1g2 A G 17: 35,236,809 K16E probably damaging Het
Bex6 G A 16: 32,186,460 E29K possibly damaging Het
Casd1 A G 6: 4,608,705 Y101C probably damaging Het
Cdx1 T C 18: 61,035,912 D70G possibly damaging Het
Cebpz T C 17: 78,935,554 T224A probably benign Het
Cep170b T C 12: 112,735,730 V319A possibly damaging Het
Chrna2 C T 14: 66,149,463 R353W possibly damaging Het
Chst5 A T 8: 111,890,544 V148E probably benign Het
Clhc1 T A 11: 29,557,771 W162R probably benign Het
Csmd1 T A 8: 16,079,978 Q1710L probably damaging Het
Ddb1 A C 19: 10,612,936 M276L probably benign Het
Dot1l C T 10: 80,785,878 R455C probably damaging Het
Dync2h1 A G 9: 7,148,735 V903A probably benign Het
Eno1b T C 18: 48,047,475 V240A possibly damaging Het
Erich1 T G 8: 14,090,527 probably benign Het
Etv1 C A 12: 38,835,116 P143Q probably null Het
Gimap8 A T 6: 48,650,568 I159F probably benign Het
Gm12666 A G 4: 92,191,656 S32P probably damaging Het
Gm8251 A C 1: 44,059,730 I736S probably benign Het
Gpr4 G A 7: 19,222,578 V142M possibly damaging Het
Gucy1a1 C T 3: 82,113,332 C86Y probably benign Het
Ifngr2 T G 16: 91,561,779 probably null Het
Insrr A T 3: 87,803,181 N398I probably damaging Het
Iws1 A G 18: 32,084,666 E441G probably damaging Het
Megf10 A T 18: 57,281,713 K732* probably null Het
Mprip T A 11: 59,749,508 probably benign Het
Mrgprb8 T C 7: 48,389,205 V208A probably benign Het
Msc G C 1: 14,755,684 P22R probably benign Het
Olfr725 A T 14: 50,034,714 S230T probably damaging Het
Opcml G A 9: 28,901,590 E193K probably damaging Het
Oxsr1 A C 9: 119,294,494 H71Q probably benign Het
Pkp2 T A 16: 16,246,967 W452R probably damaging Het
Prrc2b C T 2: 32,182,570 T20I probably damaging Het
Rasgrp3 T C 17: 75,503,141 S279P probably damaging Het
Rtl1 T A 12: 109,591,397 D1336V unknown Het
Serpina3m G T 12: 104,389,270 K65N probably benign Het
Serpine2 A G 1: 79,810,694 V182A probably damaging Het
Slc10a1 A G 12: 80,956,048 V272A possibly damaging Het
Slc25a29 A T 12: 108,827,432 N73K probably damaging Het
Slit1 G A 19: 41,606,380 R1184W probably damaging Het
Srrm2 T C 17: 23,812,429 probably benign Het
Stk11ip A G 1: 75,525,521 probably benign Het
Tcerg1 A G 18: 42,564,145 K767R possibly damaging Het
Tmem82 T C 4: 141,616,287 K224R probably benign Het
Tmprss11g A G 5: 86,499,556 L41S probably damaging Het
Trim42 T C 9: 97,366,097 N182S probably benign Het
Ttn T C 2: 76,830,088 T7430A probably benign Het
Wwp1 T C 4: 19,650,390 T259A probably benign Het
Other mutations in Ermp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01613:Ermp1 APN 19 29639939 missense probably damaging 1.00
IGL01696:Ermp1 APN 19 29646138 missense possibly damaging 0.65
IGL01759:Ermp1 APN 19 29615836 missense probably benign 0.03
IGL01891:Ermp1 APN 19 29616602 missense probably benign 0.16
IGL02008:Ermp1 APN 19 29612920 missense probably damaging 1.00
IGL02034:Ermp1 APN 19 29645959 splice site probably benign
IGL02655:Ermp1 APN 19 29646210 nonsense probably null
IGL03074:Ermp1 APN 19 29612535 missense probably damaging 1.00
PIT4366001:Ermp1 UTSW 19 29628789 missense probably benign 0.24
R0050:Ermp1 UTSW 19 29628784 missense probably damaging 0.96
R0050:Ermp1 UTSW 19 29628784 missense probably damaging 0.96
R0096:Ermp1 UTSW 19 29631388 missense possibly damaging 0.91
R0096:Ermp1 UTSW 19 29631388 missense possibly damaging 0.91
R0361:Ermp1 UTSW 19 29631406 missense probably damaging 1.00
R0684:Ermp1 UTSW 19 29632541 splice site probably benign
R0711:Ermp1 UTSW 19 29631388 missense possibly damaging 0.91
R1167:Ermp1 UTSW 19 29628679 missense possibly damaging 0.53
R1869:Ermp1 UTSW 19 29646015 missense possibly damaging 0.66
R1884:Ermp1 UTSW 19 29616679 missense probably benign 0.00
R2135:Ermp1 UTSW 19 29646065 missense possibly damaging 0.81
R2153:Ermp1 UTSW 19 29637398 critical splice acceptor site probably null
R2290:Ermp1 UTSW 19 29623778 missense probably damaging 1.00
R4176:Ermp1 UTSW 19 29645965 critical splice donor site probably null
R4363:Ermp1 UTSW 19 29612876 missense probably damaging 1.00
R4579:Ermp1 UTSW 19 29616651 missense probably damaging 0.98
R4761:Ermp1 UTSW 19 29646256 missense probably benign 0.03
R5801:Ermp1 UTSW 19 29612828 missense probably damaging 1.00
R5931:Ermp1 UTSW 19 29615729 missense probably benign 0.01
R6129:Ermp1 UTSW 19 29623209 missense possibly damaging 0.95
R6556:Ermp1 UTSW 19 29612921 missense possibly damaging 0.91
R6563:Ermp1 UTSW 19 29623778 missense probably damaging 1.00
R6598:Ermp1 UTSW 19 29632502 missense possibly damaging 0.82
R6647:Ermp1 UTSW 19 29626935 missense probably benign 0.27
R6850:Ermp1 UTSW 19 29616641 missense probably damaging 1.00
R6912:Ermp1 UTSW 19 29616611 missense probably benign 0.02
R7341:Ermp1 UTSW 19 29646254 missense probably benign 0.20
R7391:Ermp1 UTSW 19 29627068 critical splice acceptor site probably null
R7391:Ermp1 UTSW 19 29627069 critical splice acceptor site probably null
R7463:Ermp1 UTSW 19 29646262 nonsense probably null
R7471:Ermp1 UTSW 19 29612654 missense probably benign 0.06
R7831:Ermp1 UTSW 19 29617967 missense probably benign 0.00
R7914:Ermp1 UTSW 19 29617967 missense probably benign 0.00
R7919:Ermp1 UTSW 19 29632388 splice site probably null
Z1088:Ermp1 UTSW 19 29612925 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGATAACTCCAGCTGTGTCAAGTTG -3'
(R):5'- TGAGCATAGTTGTCACCCTG -3'

Sequencing Primer
(F):5'- GTCAAGTTGACACAAAACTAGCCAG -3'
(R):5'- AGCATAGTTGTCACCCTGTGATGAC -3'
Posted On2014-09-18