Mutagenetix > Incidental Mutations

Incidental Mutation 'R2095:Armc3'

232015

Institutional Source

Beutler Lab

Gene Symbol

Armc3

Ensembl Gene

ENSMUSG00000037683

Gene Name

armadillo repeat containing 3

Synonyms

4921513G22Rik

MMRRC Submission

040099-MU

Accession Numbers

Ncbi RefSeq: NM_001081083.2, NM_001271563.1, NM_001271564.1, NM_001271565.1; MGI:1918132

Is this an essential gene?

Probably non essential (E-score: 0.073) question?

Stock #

R2095 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

19199302-19310241 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 19288929 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 510 (D510E)

Ref Sequence

ENSEMBL: ENSMUSP00000048784 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049255] [ENSMUST00000114640]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000049255
AA Change: D510E

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000048784
Gene: ENSMUSG00000037683
AA Change: D510E

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
ARM	56	96	2.07e-2	SMART
ARM	97	138	9.84e1	SMART
ARM	139	179	7.86e-3	SMART
ARM	180	220	7.63e0	SMART
ARM	221	262	7.76e1	SMART
low complexity region	293	303	N/A	INTRINSIC
ARM	305	345	3.91e1	SMART
ARM	346	385	2.93e-2	SMART
ARM	387	427	7.74e-2	SMART
Blast:ARM	428	468	3e-11	BLAST
ARM	469	509	1.45e-1	SMART
low complexity region	544	557	N/A	INTRINSIC
low complexity region	583	595	N/A	INTRINSIC
low complexity region	620	639	N/A	INTRINSIC
low complexity region	675	696	N/A	INTRINSIC
Pfam:EDR1	723	857	3.1e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000114640
AA Change: D510E

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000110287
Gene: ENSMUSG00000037683
AA Change: D510E

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
ARM	56	96	2.07e-2	SMART
ARM	97	138	9.84e1	SMART
ARM	139	179	7.86e-3	SMART
ARM	180	220	7.63e0	SMART
ARM	221	262	7.76e1	SMART
low complexity region	293	303	N/A	INTRINSIC
ARM	305	345	3.91e1	SMART
ARM	346	385	2.93e-2	SMART
ARM	387	427	7.74e-2	SMART
Blast:ARM	428	468	3e-11	BLAST
ARM	469	509	1.45e-1	SMART
Pfam:EDR1	549	868	1.4e-41	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.5%
20x: 95.6%

Validation Efficiency

97% (58/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Armadillo/beta-catenin (CTNNB1; MIM 116806)-like (ARM) domains are imperfect 45-amino acid repeats involved in protein-protein interactions. ARM domain-containing proteins, such as ARMC3, function in signal transduction, development, cell adhesion and mobility, and tumor initiation and metastasis (Li et al., 2006 [PubMed 16915934]).[supplied by OMIM, Mar 2008]

Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530002B09Rik	C	A	4: 122,702,358	Y127*	probably null	Het
Adam33	C	T	2: 131,053,709	G562D	probably damaging	Het
Adh1	T	C	3: 138,282,796	F177L	probably damaging	Het
Arhgef17	T	C	7: 100,881,263	T1439A	probably damaging	Het
Arl5c	C	T	11: 97,993,451	E105K	probably damaging	Het
Bbx	T	C	16: 50,224,689	E395G	possibly damaging	Het
Cacna2d2	G	A	9: 107,527,165	E1087K	probably benign	Het
Casq1	T	C	1: 172,215,962	N113S	probably benign	Het
Cbfa2t3	A	G	8: 122,634,988	S432P	probably benign	Het
Cd163	A	G	6: 124,317,822	D615G	probably damaging	Het
Chrnb2	A	T	3: 89,761,437	D190E	probably benign	Het
Clec9a	T	C	6: 129,416,358	L115P	possibly damaging	Het
Cluh	C	T	11: 74,661,724	R532*	probably null	Het
Cntnap5a	T	A	1: 116,442,260	L869Q	probably damaging	Het
Ctgf	T	C	10: 24,596,479	V140A	probably benign	Het
Cyp3a57	A	T	5: 145,369,134	K143*	probably null	Het
Dcaf12	G	T	4: 41,294,085	H351N	probably benign	Het
Dtna	T	A	18: 23,569,748	L112Q	probably damaging	Het
Fnta	G	A	8: 25,999,879	Q303*	probably null	Het
Frs2	T	C	10: 117,074,602	E285G	probably benign	Het
Gabra4	T	C	5: 71,624,112	I293V	probably damaging	Het
Gm2431	A	T	7: 142,257,781	C129S	unknown	Het
Gnl2	C	T	4: 125,034,318	R49C	probably damaging	Het
Helz	T	A	11: 107,646,146	Y275N	probably damaging	Het
Hydin	A	G	8: 110,462,657	E1231G	probably damaging	Het
Kctd11	T	A	11: 69,879,576	D212V	probably damaging	Het
Klf3	T	A	5: 64,821,902	M29K	probably benign	Het
Klhl21	T	C	4: 152,009,393	S151P	probably benign	Het
Lsm14b	A	T	2: 180,031,787		probably benign	Het
Mlxipl	T	C	5: 135,122,120		probably benign	Het
Mov10	G	A	3: 104,801,531	R389C	probably damaging	Het
Msh6	A	G	17: 87,988,233	M1071V	possibly damaging	Het
Myh8	G	T	11: 67,286,224	A401S	probably benign	Het
Ndufv3	T	C	17: 31,527,486	S117P	possibly damaging	Het
Obscn	A	T	11: 59,093,584		probably null	Het
Olfr1205	T	C	2: 88,831,290	Y58H	probably damaging	Het
Olfr150	T	A	9: 39,737,261	Y149N	probably damaging	Het
Olfr166	T	C	16: 19,486,931	I31T	probably benign	Het
Olfr381	T	A	11: 73,486,594	T77S	probably damaging	Het
Pcdhb17	T	A	18: 37,486,322	D388E	probably benign	Het
Pgm3	T	C	9: 86,556,341	T423A	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
S1pr5	T	A	9: 21,244,858	T91S	probably benign	Het
Sgcz	T	C	8: 37,540,392		probably benign	Het
Slc33a1	A	G	3: 63,963,955	L79P	probably damaging	Het
Slco2a1	A	G	9: 103,076,968	T383A	probably benign	Het
Slit1	G	A	19: 41,606,380	R1184W	probably damaging	Het
Spta1	T	A	1: 174,244,198	M2248K	possibly damaging	Het
Stub1	A	G	17: 25,830,890	Y304H	probably damaging	Het
Taar7e	T	A	10: 24,038,051	Y146*	probably null	Het
Tbc1d1	C	T	5: 64,316,501	S660L	probably benign	Het
Tcea2	C	A	2: 181,686,932	F259L	probably damaging	Het
Tcp11l1	T	A	2: 104,681,840	K482N	probably damaging	Het
Trpv6	C	T	6: 41,621,756	R645Q	probably damaging	Het
Uaca	T	A	9: 60,840,843	S30T	probably benign	Het
Ubap2	C	G	4: 41,206,901	V492L	possibly damaging	Het
Ube3c	T	C	5: 29,668,040	F1026S	probably damaging	Het
Vmn2r8	T	G	5: 108,808,621	D45A	possibly damaging	Het
Zfp738	G	T	13: 67,671,303	L180I	probably damaging	Het

Other mutations in Armc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00535:Armc3	APN	2	19303858	missense	possibly damaging	0.48
IGL01123:Armc3	APN	2	19201805	missense	possibly damaging	0.87
IGL01142:Armc3	APN	2	19297898	splice site	probably benign
IGL01556:Armc3	APN	2	19269146	missense	probably damaging	1.00
IGL02145:Armc3	APN	2	19296860	missense	possibly damaging	0.81
IGL02145:Armc3	APN	2	19286137	critical splice donor site	probably null
IGL02152:Armc3	APN	2	19286137	critical splice donor site	probably null
IGL02154:Armc3	APN	2	19286137	critical splice donor site	probably null
IGL02243:Armc3	APN	2	19286137	critical splice donor site	probably null
IGL02244:Armc3	APN	2	19286137	critical splice donor site	probably null
IGL02516:Armc3	APN	2	19300506	missense	possibly damaging	0.94
IGL02691:Armc3	APN	2	19235484	missense	probably damaging	1.00
IGL03151:Armc3	APN	2	19238698	missense	probably damaging	1.00
IGL03190:Armc3	APN	2	19288950	missense	probably damaging	0.99
IGL03288:Armc3	APN	2	19235482	missense	probably damaging	1.00
IGL03338:Armc3	APN	2	19248701	missense	possibly damaging	0.88
R0015:Armc3	UTSW	2	19296321	critical splice acceptor site	probably null
R0015:Armc3	UTSW	2	19296321	critical splice acceptor site	probably null
R0256:Armc3	UTSW	2	19269216	missense	probably damaging	1.00
R0621:Armc3	UTSW	2	19295393	missense	probably damaging	0.96
R1326:Armc3	UTSW	2	19310124	makesense	probably null
R1470:Armc3	UTSW	2	19238736	missense	probably benign
R1470:Armc3	UTSW	2	19238736	missense	probably benign
R1489:Armc3	UTSW	2	19310047	missense	probably benign	0.01
R1990:Armc3	UTSW	2	19293142	missense	probably damaging	0.97
R1991:Armc3	UTSW	2	19293142	missense	probably damaging	0.97
R1992:Armc3	UTSW	2	19293142	missense	probably damaging	0.97
R2002:Armc3	UTSW	2	19288936	missense	probably benign	0.01
R2127:Armc3	UTSW	2	19201811	missense	probably damaging	1.00
R2158:Armc3	UTSW	2	19248633	missense	probably damaging	0.99
R2697:Armc3	UTSW	2	19303935	missense	probably damaging	1.00
R3809:Armc3	UTSW	2	19300665	missense	probably damaging	1.00
R3897:Armc3	UTSW	2	19269177	missense	probably damaging	1.00
R4107:Armc3	UTSW	2	19288909	missense	probably benign	0.13
R4326:Armc3	UTSW	2	19300473	missense	probably damaging	0.97
R4464:Armc3	UTSW	2	19248659	missense	probably damaging	0.99
R4702:Armc3	UTSW	2	19309981	missense	probably damaging	1.00
R4923:Armc3	UTSW	2	19292980	critical splice acceptor site	probably null
R5370:Armc3	UTSW	2	19286062	missense	probably benign	0.00
R5518:Armc3	UTSW	2	19297928	missense	probably benign	0.28
R5718:Armc3	UTSW	2	19303799	nonsense	probably null
R5739:Armc3	UTSW	2	19253917	missense	possibly damaging	0.67
R5913:Armc3	UTSW	2	19310047	missense	possibly damaging	0.65
R6211:Armc3	UTSW	2	19296803	critical splice acceptor site	probably null
R6245:Armc3	UTSW	2	19248705	missense	probably damaging	1.00
R6841:Armc3	UTSW	2	19201819	splice site	probably null
R7003:Armc3	UTSW	2	19270028	missense	probably damaging	1.00
R7190:Armc3	UTSW	2	19293136	missense	probably damaging	1.00
R7499:Armc3	UTSW	2	19285979	missense	probably benign	0.03
R7738:Armc3	UTSW	2	19288950	missense	probably damaging	0.99
R7844:Armc3	UTSW	2	19254018	missense	possibly damaging	0.90
R7919:Armc3	UTSW	2	19286095	missense	probably benign	0.00
R8060:Armc3	UTSW	2	19288909	missense	probably benign	0.08
R8111:Armc3	UTSW	2	19296863	missense	probably benign
R8406:Armc3	UTSW	2	19235554	missense	probably damaging	0.98
R8485:Armc3	UTSW	2	19293134	missense	probably damaging	1.00
R8773:Armc3	UTSW	2	19288856	missense	probably benign	0.01
Z1177:Armc3	UTSW	2	19285991	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTGGCACATTCGAAAACAGTTG -3'
(R):5'- ACTAGGGAAAGATGGCCTGC -3'

Sequencing Primer
(F):5'- ACCCAGGATTCTATGTATGTCAGGC -3'
(R):5'- AAAGATGGCCTGCCCCAG -3'

Posted On

2014-09-18