Incidental Mutation 'R2095:Adam33'
ID232019
Institutional Source Beutler Lab
Gene Symbol Adam33
Ensembl Gene ENSMUSG00000027318
Gene Namea disintegrin and metallopeptidase domain 33
Synonyms
MMRRC Submission 040099-MU
Accession Numbers

Genbank: NM_033615, NM_001163529; MGI: 1341813

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2095 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location131050591-131063814 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 131053709 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 562 (G562D)
Ref Sequence ENSEMBL: ENSMUSP00000139344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052104] [ENSMUST00000110232] [ENSMUST00000183552]
Predicted Effect probably damaging
Transcript: ENSMUST00000052104
AA Change: G562D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052486
Gene: ENSMUSG00000027318
AA Change: G562D

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Pep_M12B_propep 38 168 1.9e-28 PFAM
Pfam:Reprolysin_5 209 390 6.9e-21 PFAM
Pfam:Reprolysin_4 209 401 3.5e-9 PFAM
Pfam:Reprolysin 211 410 1.9e-60 PFAM
Pfam:Reprolysin_2 232 400 3e-14 PFAM
Pfam:Reprolysin_3 235 357 1.2e-16 PFAM
DISIN 427 502 8.4e-42 SMART
ACR 503 647 6.8e-51 SMART
transmembrane domain 677 699 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110232
AA Change: G562D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105861
Gene: ENSMUSG00000027318
AA Change: G562D

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:Pep_M12B_propep 36 168 1.3e-24 PFAM
Pfam:Reprolysin_5 209 390 8.5e-23 PFAM
Pfam:Reprolysin_4 209 401 4.2e-11 PFAM
Pfam:Reprolysin 211 410 4e-63 PFAM
Pfam:Reprolysin_2 231 400 7.3e-17 PFAM
Pfam:Reprolysin_3 235 357 2.2e-20 PFAM
DISIN 427 502 1.66e-39 SMART
ACR 503 646 7.59e-54 SMART
EGF 653 682 1.53e-1 SMART
transmembrane domain 703 725 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132436
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134742
Predicted Effect unknown
Transcript: ENSMUST00000135149
AA Change: G420D
SMART Domains Protein: ENSMUSP00000122608
Gene: ENSMUSG00000027318
AA Change: G420D

DomainStartEndE-ValueType
Pfam:Reprolysin_5 68 249 1.8e-23 PFAM
Pfam:Reprolysin_4 68 260 8.6e-12 PFAM
Pfam:Reprolysin 70 269 8.3e-64 PFAM
Pfam:Reprolysin_2 90 259 1.5e-17 PFAM
Pfam:Reprolysin_3 94 216 5.1e-21 PFAM
DISIN 286 361 1.66e-39 SMART
ACR 362 505 8.02e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147333
SMART Domains Protein: ENSMUSP00000117097
Gene: ENSMUSG00000027318

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 74 92 N/A INTRINSIC
low complexity region 138 150 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149625
Predicted Effect probably damaging
Transcript: ENSMUST00000183552
AA Change: G562D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139344
Gene: ENSMUSG00000027318
AA Change: G562D

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:Pep_M12B_propep 38 168 2.4e-30 PFAM
Pfam:Reprolysin_5 209 390 8.2e-23 PFAM
Pfam:Reprolysin_4 209 401 4.2e-11 PFAM
Pfam:Reprolysin 211 410 2.4e-62 PFAM
Pfam:Reprolysin_2 232 400 2.8e-16 PFAM
Pfam:Reprolysin_3 235 357 1.5e-18 PFAM
DISIN 427 502 1.66e-39 SMART
ACR 503 646 7.59e-54 SMART
EGF 653 682 1.53e-1 SMART
transmembrane domain 703 725 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184921
Meta Mutation Damage Score 0.5581 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is widely expressed, most highly in the adult brain, heart, kidney, lung and testis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional metalloprotease enzyme. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a targeted gene deletion are viable, fertile, developmentally normal and display normal allergen-induced airway hyperreactivity, IgE production, mucus metaplasia, and airway inflammation in an OVA-induced model of allergic asthma. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(2) Targeted, other(4)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik C A 4: 122,702,358 Y127* probably null Het
Adh1 T C 3: 138,282,796 F177L probably damaging Het
Arhgef17 T C 7: 100,881,263 T1439A probably damaging Het
Arl5c C T 11: 97,993,451 E105K probably damaging Het
Armc3 T A 2: 19,288,929 D510E possibly damaging Het
Bbx T C 16: 50,224,689 E395G possibly damaging Het
Cacna2d2 G A 9: 107,527,165 E1087K probably benign Het
Casq1 T C 1: 172,215,962 N113S probably benign Het
Cbfa2t3 A G 8: 122,634,988 S432P probably benign Het
Cd163 A G 6: 124,317,822 D615G probably damaging Het
Chrnb2 A T 3: 89,761,437 D190E probably benign Het
Clec9a T C 6: 129,416,358 L115P possibly damaging Het
Cluh C T 11: 74,661,724 R532* probably null Het
Cntnap5a T A 1: 116,442,260 L869Q probably damaging Het
Ctgf T C 10: 24,596,479 V140A probably benign Het
Cyp3a57 A T 5: 145,369,134 K143* probably null Het
Dcaf12 G T 4: 41,294,085 H351N probably benign Het
Dtna T A 18: 23,569,748 L112Q probably damaging Het
Fnta G A 8: 25,999,879 Q303* probably null Het
Frs2 T C 10: 117,074,602 E285G probably benign Het
Gabra4 T C 5: 71,624,112 I293V probably damaging Het
Gm2431 A T 7: 142,257,781 C129S unknown Het
Gnl2 C T 4: 125,034,318 R49C probably damaging Het
Helz T A 11: 107,646,146 Y275N probably damaging Het
Hydin A G 8: 110,462,657 E1231G probably damaging Het
Kctd11 T A 11: 69,879,576 D212V probably damaging Het
Klf3 T A 5: 64,821,902 M29K probably benign Het
Klhl21 T C 4: 152,009,393 S151P probably benign Het
Lsm14b A T 2: 180,031,787 probably benign Het
Mlxipl T C 5: 135,122,120 probably benign Het
Mov10 G A 3: 104,801,531 R389C probably damaging Het
Msh6 A G 17: 87,988,233 M1071V possibly damaging Het
Myh8 G T 11: 67,286,224 A401S probably benign Het
Ndufv3 T C 17: 31,527,486 S117P possibly damaging Het
Obscn A T 11: 59,093,584 probably null Het
Olfr1205 T C 2: 88,831,290 Y58H probably damaging Het
Olfr150 T A 9: 39,737,261 Y149N probably damaging Het
Olfr166 T C 16: 19,486,931 I31T probably benign Het
Olfr381 T A 11: 73,486,594 T77S probably damaging Het
Pcdhb17 T A 18: 37,486,322 D388E probably benign Het
Pgm3 T C 9: 86,556,341 T423A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
S1pr5 T A 9: 21,244,858 T91S probably benign Het
Sgcz T C 8: 37,540,392 probably benign Het
Slc33a1 A G 3: 63,963,955 L79P probably damaging Het
Slco2a1 A G 9: 103,076,968 T383A probably benign Het
Slit1 G A 19: 41,606,380 R1184W probably damaging Het
Spta1 T A 1: 174,244,198 M2248K possibly damaging Het
Stub1 A G 17: 25,830,890 Y304H probably damaging Het
Taar7e T A 10: 24,038,051 Y146* probably null Het
Tbc1d1 C T 5: 64,316,501 S660L probably benign Het
Tcea2 C A 2: 181,686,932 F259L probably damaging Het
Tcp11l1 T A 2: 104,681,840 K482N probably damaging Het
Trpv6 C T 6: 41,621,756 R645Q probably damaging Het
Uaca T A 9: 60,840,843 S30T probably benign Het
Ubap2 C G 4: 41,206,901 V492L possibly damaging Het
Ube3c T C 5: 29,668,040 F1026S probably damaging Het
Vmn2r8 T G 5: 108,808,621 D45A possibly damaging Het
Zfp738 G T 13: 67,671,303 L180I probably damaging Het
Other mutations in Adam33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Adam33 APN 2 131054263 splice site probably benign
IGL01586:Adam33 APN 2 131054050 missense probably damaging 1.00
IGL02156:Adam33 APN 2 131053158 splice site probably benign
IGL02498:Adam33 APN 2 131053237 missense probably damaging 1.00
3-1:Adam33 UTSW 2 131054121 splice site probably null
R0012:Adam33 UTSW 2 131052920 missense probably damaging 1.00
R0471:Adam33 UTSW 2 131054479 missense probably damaging 0.99
R1401:Adam33 UTSW 2 131051471 unclassified probably benign
R2071:Adam33 UTSW 2 131055346 missense probably benign 0.01
R2383:Adam33 UTSW 2 131051362 missense probably benign 0.01
R4077:Adam33 UTSW 2 131063524 utr 5 prime probably benign
R4403:Adam33 UTSW 2 131053270 missense probably benign 0.03
R4821:Adam33 UTSW 2 131061195 missense probably benign 0.03
R5110:Adam33 UTSW 2 131053770 missense probably damaging 1.00
R5150:Adam33 UTSW 2 131053197 intron probably benign
R5364:Adam33 UTSW 2 131054472 critical splice donor site probably null
R5632:Adam33 UTSW 2 131053442 missense probably damaging 1.00
R5818:Adam33 UTSW 2 131054358 missense possibly damaging 0.51
R6226:Adam33 UTSW 2 131055610 missense probably damaging 1.00
R6478:Adam33 UTSW 2 131051346 missense probably benign 0.01
R6755:Adam33 UTSW 2 131053149 missense probably damaging 1.00
R7230:Adam33 UTSW 2 131053563 missense probably damaging 1.00
R7322:Adam33 UTSW 2 131053694 missense probably damaging 1.00
R7395:Adam33 UTSW 2 131061169 missense probably benign 0.00
R7650:Adam33 UTSW 2 131061147 missense probably damaging 1.00
R7783:Adam33 UTSW 2 131058337 missense unknown
R7809:Adam33 UTSW 2 131051346 missense probably benign
Z1177:Adam33 UTSW 2 131058662 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGCCCTCTAGGAGAATTGTG -3'
(R):5'- TGGTGCCCTGACCAATACTAAAAC -3'

Sequencing Primer
(F):5'- ATAGTCACTATGTGCGGCAC -3'
(R):5'- AACCTGCGGTTTTCTACTGAG -3'
Posted On2014-09-18