Incidental Mutation 'R2095:Tcea2'
ID232021
Institutional Source Beutler Lab
Gene Symbol Tcea2
Ensembl Gene ENSMUSG00000059540
Gene Nametranscription elongation factor A (SII), 2
SynonymsSII-T1, Tceat, S-II-T1
MMRRC Submission 040099-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R2095 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location181680310-181688071 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 181686932 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 259 (F259L)
Ref Sequence ENSEMBL: ENSMUSP00000099331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002532] [ENSMUST00000103042] [ENSMUST00000108769] [ENSMUST00000108771] [ENSMUST00000108772] [ENSMUST00000108776] [ENSMUST00000108778] [ENSMUST00000108779] [ENSMUST00000129745] [ENSMUST00000165416]
Predicted Effect probably benign
Transcript: ENSMUST00000002532
SMART Domains Protein: ENSMUSP00000002532
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
RGS 90 206 2.73e-43 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103042
AA Change: F259L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099331
Gene: ENSMUSG00000059540
AA Change: F259L

DomainStartEndE-ValueType
TFS2N 7 81 2.51e-25 SMART
low complexity region 114 129 N/A INTRINSIC
TFS2M 136 237 4.14e-51 SMART
ZnF_C2C2 259 298 7.37e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108769
SMART Domains Protein: ENSMUSP00000104400
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
Pfam:RGS 90 160 4.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108771
SMART Domains Protein: ENSMUSP00000104402
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
RGS 68 184 2.73e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108772
SMART Domains Protein: ENSMUSP00000104403
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
RGS 68 184 2.73e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108776
SMART Domains Protein: ENSMUSP00000104406
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
RGS 90 206 2.73e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108778
SMART Domains Protein: ENSMUSP00000104408
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 66 78 N/A INTRINSIC
RGS 117 233 2.73e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108779
SMART Domains Protein: ENSMUSP00000104409
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124776
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126623
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126844
Predicted Effect probably damaging
Transcript: ENSMUST00000129006
AA Change: F256L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120083
Gene: ENSMUSG00000059540
AA Change: F256L

DomainStartEndE-ValueType
Pfam:Med26 27 77 5.1e-17 PFAM
low complexity region 112 127 N/A INTRINSIC
TFS2M 134 235 4.14e-51 SMART
ZnF_C2C2 257 296 7.37e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129686
Predicted Effect probably benign
Transcript: ENSMUST00000129745
AA Change: F252L

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000119646
Gene: ENSMUSG00000059540
AA Change: F252L

DomainStartEndE-ValueType
Pfam:Med26 21 73 2.1e-20 PFAM
low complexity region 107 122 N/A INTRINSIC
TFS2M 129 230 4.14e-51 SMART
ZnF_C2C2 252 291 7.37e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130712
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143510
Predicted Effect probably benign
Transcript: ENSMUST00000144476
SMART Domains Protein: ENSMUSP00000120723
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
Pfam:RGS 1 49 3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165416
SMART Domains Protein: ENSMUSP00000129026
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
RGS 90 206 2.73e-43 SMART
Meta Mutation Damage Score 0.1703 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in the nucleus, where it functions as an SII class transcription elongation factor. Elongation factors in this class are responsible for releasing RNA polymerase II ternary complexes from transcriptional arrest at template-encoded arresting sites. The encoded protein has been shown to interact with general transcription factor IIB, a basal transcription factor. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik C A 4: 122,702,358 Y127* probably null Het
Adam33 C T 2: 131,053,709 G562D probably damaging Het
Adh1 T C 3: 138,282,796 F177L probably damaging Het
Arhgef17 T C 7: 100,881,263 T1439A probably damaging Het
Arl5c C T 11: 97,993,451 E105K probably damaging Het
Armc3 T A 2: 19,288,929 D510E possibly damaging Het
Bbx T C 16: 50,224,689 E395G possibly damaging Het
Cacna2d2 G A 9: 107,527,165 E1087K probably benign Het
Casq1 T C 1: 172,215,962 N113S probably benign Het
Cbfa2t3 A G 8: 122,634,988 S432P probably benign Het
Cd163 A G 6: 124,317,822 D615G probably damaging Het
Chrnb2 A T 3: 89,761,437 D190E probably benign Het
Clec9a T C 6: 129,416,358 L115P possibly damaging Het
Cluh C T 11: 74,661,724 R532* probably null Het
Cntnap5a T A 1: 116,442,260 L869Q probably damaging Het
Ctgf T C 10: 24,596,479 V140A probably benign Het
Cyp3a57 A T 5: 145,369,134 K143* probably null Het
Dcaf12 G T 4: 41,294,085 H351N probably benign Het
Dtna T A 18: 23,569,748 L112Q probably damaging Het
Fnta G A 8: 25,999,879 Q303* probably null Het
Frs2 T C 10: 117,074,602 E285G probably benign Het
Gabra4 T C 5: 71,624,112 I293V probably damaging Het
Gm2431 A T 7: 142,257,781 C129S unknown Het
Gnl2 C T 4: 125,034,318 R49C probably damaging Het
Helz T A 11: 107,646,146 Y275N probably damaging Het
Hydin A G 8: 110,462,657 E1231G probably damaging Het
Kctd11 T A 11: 69,879,576 D212V probably damaging Het
Klf3 T A 5: 64,821,902 M29K probably benign Het
Klhl21 T C 4: 152,009,393 S151P probably benign Het
Lsm14b A T 2: 180,031,787 probably benign Het
Mlxipl T C 5: 135,122,120 probably benign Het
Mov10 G A 3: 104,801,531 R389C probably damaging Het
Msh6 A G 17: 87,988,233 M1071V possibly damaging Het
Myh8 G T 11: 67,286,224 A401S probably benign Het
Ndufv3 T C 17: 31,527,486 S117P possibly damaging Het
Obscn A T 11: 59,093,584 probably null Het
Olfr1205 T C 2: 88,831,290 Y58H probably damaging Het
Olfr150 T A 9: 39,737,261 Y149N probably damaging Het
Olfr166 T C 16: 19,486,931 I31T probably benign Het
Olfr381 T A 11: 73,486,594 T77S probably damaging Het
Pcdhb17 T A 18: 37,486,322 D388E probably benign Het
Pgm3 T C 9: 86,556,341 T423A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
S1pr5 T A 9: 21,244,858 T91S probably benign Het
Sgcz T C 8: 37,540,392 probably benign Het
Slc33a1 A G 3: 63,963,955 L79P probably damaging Het
Slco2a1 A G 9: 103,076,968 T383A probably benign Het
Slit1 G A 19: 41,606,380 R1184W probably damaging Het
Spta1 T A 1: 174,244,198 M2248K possibly damaging Het
Stub1 A G 17: 25,830,890 Y304H probably damaging Het
Taar7e T A 10: 24,038,051 Y146* probably null Het
Tbc1d1 C T 5: 64,316,501 S660L probably benign Het
Tcp11l1 T A 2: 104,681,840 K482N probably damaging Het
Trpv6 C T 6: 41,621,756 R645Q probably damaging Het
Uaca T A 9: 60,840,843 S30T probably benign Het
Ubap2 C G 4: 41,206,901 V492L possibly damaging Het
Ube3c T C 5: 29,668,040 F1026S probably damaging Het
Vmn2r8 T G 5: 108,808,621 D45A possibly damaging Het
Zfp738 G T 13: 67,671,303 L180I probably damaging Het
Other mutations in Tcea2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02118:Tcea2 APN 2 181685835 missense probably benign 0.02
R0009:Tcea2 UTSW 2 181685817 missense probably benign
R0513:Tcea2 UTSW 2 181684481 missense probably benign 0.19
R0626:Tcea2 UTSW 2 181687638 missense probably damaging 1.00
R1228:Tcea2 UTSW 2 181684445 missense probably benign 0.11
R1540:Tcea2 UTSW 2 181686958 missense possibly damaging 0.55
R4735:Tcea2 UTSW 2 181686721 missense probably damaging 1.00
R5499:Tcea2 UTSW 2 181680434 missense probably damaging 0.99
R7039:Tcea2 UTSW 2 181686918 nonsense probably null
R7411:Tcea2 UTSW 2 181686664 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAGAGGTGAGTGCCACTG -3'
(R):5'- GAGTCCATATAGCCTTCCCAC -3'

Sequencing Primer
(F):5'- TGAGTGCCACTGGAAGGGC -3'
(R):5'- TAGCAGGATCTGAAGGTCCCAC -3'
Posted On2014-09-18