Incidental Mutation 'R0193:Ccdc180'
ID23203
Institutional Source Beutler Lab
Gene Symbol Ccdc180
Ensembl Gene ENSMUSG00000035539
Gene Namecoiled-coil domain containing 180
SynonymsE230008N13Rik, LOC381522
MMRRC Submission 038452-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0193 (G1)
Quality Score225
Status Validated (trace)
Chromosome4
Chromosomal Location45890303-45950774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 45914803 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 145 (E145K)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178561]
Predicted Effect unknown
Transcript: ENSMUST00000149903
AA Change: E765K
SMART Domains Protein: ENSMUSP00000119784
Gene: ENSMUSG00000035539
AA Change: E765K

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
coiled coil region 90 117 N/A INTRINSIC
Pfam:DUF4455 141 609 2e-189 PFAM
low complexity region 628 642 N/A INTRINSIC
low complexity region 658 675 N/A INTRINSIC
coiled coil region 710 780 N/A INTRINSIC
coiled coil region 945 979 N/A INTRINSIC
low complexity region 1100 1123 N/A INTRINSIC
Pfam:DUF4456 1169 1372 9.5e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151024
AA Change: E145K

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000122332
Gene: ENSMUSG00000035539
AA Change: E145K

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
coiled coil region 90 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178561
AA Change: E773K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136714
Gene: ENSMUSG00000035539
AA Change: E773K

DomainStartEndE-ValueType
low complexity region 32 49 N/A INTRINSIC
coiled coil region 98 125 N/A INTRINSIC
Pfam:DUF4455 148 616 7.3e-189 PFAM
low complexity region 635 649 N/A INTRINSIC
low complexity region 665 682 N/A INTRINSIC
coiled coil region 718 788 N/A INTRINSIC
coiled coil region 1121 1155 N/A INTRINSIC
low complexity region 1275 1298 N/A INTRINSIC
Pfam:DUF4456 1344 1547 2.2e-76 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 94.7%
  • 20x: 85.3%
Validation Efficiency 95% (186/196)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a coiled-coil domain. Alternative splicing results in multiple transcript variants encoding different isoforms. A single nucleotide polymorphism (SNP) in this gene has been associated with increased susceptibility to Behcet's Disease (PMID: 19442274). [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,422,359 Q352L probably damaging Het
Adgrb1 T C 15: 74,572,156 S96P probably damaging Het
Akr1c20 A G 13: 4,511,293 probably benign Het
Atp2a3 G T 11: 72,972,220 V99L possibly damaging Het
Atp6v0a1 T A 11: 101,048,482 I691N possibly damaging Het
Atp8b1 C T 18: 64,561,636 R525Q probably benign Het
Aurkb A G 11: 69,048,544 D151G probably damaging Het
Bank1 A T 3: 136,066,518 probably benign Het
Bcl9l T C 9: 44,507,406 L847P probably damaging Het
Bscl2 T A 19: 8,847,429 M292K probably benign Het
Cacna1c C T 6: 118,602,402 probably benign Het
Cadps2 T C 6: 23,599,440 K260R probably benign Het
Cc2d2a T C 5: 43,736,118 S1419P probably damaging Het
Ccdc58 T C 16: 36,082,814 S59P probably damaging Het
Ccno C T 13: 112,988,884 probably benign Het
Cd300a A G 11: 114,893,376 D70G probably benign Het
Cenpc1 T C 5: 86,032,403 D670G probably benign Het
Cenpl A G 1: 161,085,988 I323V probably damaging Het
Cfap44 A G 16: 44,449,210 probably null Het
Cfap74 C T 4: 155,426,115 R386C probably benign Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Clcnkb T C 4: 141,412,316 E125G possibly damaging Het
Clstn1 G A 4: 149,634,796 V361M probably damaging Het
Coro7 G A 16: 4,627,504 probably benign Het
Dchs1 C T 7: 105,764,983 R875H probably benign Het
Eif3j1 A C 2: 122,052,027 M239L probably benign Het
Eif4g3 G T 4: 138,146,376 probably benign Het
Erbb4 T C 1: 68,043,960 probably benign Het
Erlin2 T G 8: 27,031,764 V164G possibly damaging Het
Fbxo43 G T 15: 36,161,883 Q393K probably benign Het
Fcgr4 A T 1: 171,025,760 N178I possibly damaging Het
Grid2 A G 6: 64,063,953 N293S possibly damaging Het
H2-M1 C T 17: 36,671,332 V126I probably benign Het
Htr1f T A 16: 64,926,749 Y60F probably damaging Het
Ilf2 A G 3: 90,481,339 probably null Het
Impg2 A T 16: 56,265,049 K931* probably null Het
Ints1 T C 5: 139,751,730 E2176G probably damaging Het
Iqsec2 T C X: 152,223,403 V1319A probably benign Het
Iqsec3 G T 6: 121,410,724 D685E probably damaging Het
Itgbl1 G A 14: 123,846,546 V279I probably benign Het
Kdm4b C T 17: 56,393,952 A541V probably benign Het
Kif14 A T 1: 136,468,438 T161S probably benign Het
Krt86 T C 15: 101,479,363 probably benign Het
Kyat1 C T 2: 30,187,186 probably null Het
Limch1 T C 5: 67,027,539 W791R probably damaging Het
Map3k11 T A 19: 5,695,846 M396K probably damaging Het
Mat2a A G 6: 72,436,195 probably null Het
Mbnl2 A G 14: 120,379,237 I88V possibly damaging Het
Mib2 T C 4: 155,655,673 T708A probably benign Het
Mkks T C 2: 136,877,606 probably null Het
Mtss1 T C 15: 58,944,017 M565V probably damaging Het
Myoc A G 1: 162,649,035 N436S probably damaging Het
Myod1 T A 7: 46,377,112 V147E probably damaging Het
Ngef A G 1: 87,509,334 L144P probably benign Het
Ngrn C T 7: 80,261,930 R92W probably damaging Het
Nup153 G A 13: 46,709,654 T349I probably benign Het
Olfr1211 T A 2: 88,930,283 I11L probably benign Het
Olfr600 G T 7: 103,346,204 S241R possibly damaging Het
Pigl A G 11: 62,503,748 I135M probably damaging Het
Pitpnm3 A G 11: 72,070,492 probably benign Het
Pkhd1 A T 1: 20,358,917 F2420I probably damaging Het
Polr2b C T 5: 77,320,076 T119M probably damaging Het
Prr29 A G 11: 106,376,896 Y130C probably damaging Het
Rab11fip3 T C 17: 25,990,999 I1048V probably damaging Het
Rab12 G A 17: 66,500,362 T124I probably damaging Het
Rab44 A G 17: 29,140,307 S490G probably benign Het
Rasa3 A G 8: 13,570,233 probably null Het
Rhbdl3 C T 11: 80,353,574 S369L possibly damaging Het
Rimbp2 A T 5: 128,788,356 S643T probably benign Het
Rin1 T G 19: 5,052,652 S396R probably damaging Het
Rpusd3 C T 6: 113,419,237 G28S probably damaging Het
Rtl9 T A X: 143,100,278 S229T probably damaging Het
Rufy1 G T 11: 50,389,852 T701N probably benign Het
Scn4a A T 11: 106,320,538 L1551* probably null Het
Sec24b T C 3: 129,988,984 N1119S probably null Het
Serbp1 T A 6: 67,272,884 *75R probably null Het
Setx C T 2: 29,179,673 P2497S probably benign Het
Slc26a11 A T 11: 119,359,314 I132F probably damaging Het
Slc4a1 A G 11: 102,352,684 V707A possibly damaging Het
Slfn1 A G 11: 83,121,843 I262V probably damaging Het
Tmem168 T A 6: 13,583,313 D523V possibly damaging Het
Traf7 G T 17: 24,510,551 Q469K probably benign Het
Trdmt1 C A 2: 13,544,617 V6F probably damaging Het
Tsacc A T 3: 88,287,088 probably benign Het
Vmn2r5 A G 3: 64,491,530 I589T possibly damaging Het
Vmn2r7 T C 3: 64,691,039 D699G probably damaging Het
Vmn2r82 T C 10: 79,381,295 V487A probably damaging Het
Zfp287 A T 11: 62,715,029 S351T probably benign Het
Zfp651 T C 9: 121,767,666 V696A probably damaging Het
Zfp654 T C 16: 64,785,688 H176R possibly damaging Het
Other mutations in Ccdc180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01369:Ccdc180 APN 4 45900256 missense probably benign
IGL01713:Ccdc180 APN 4 45921025 critical splice donor site probably null
IGL01915:Ccdc180 APN 4 45904544 missense probably damaging 0.98
IGL01935:Ccdc180 APN 4 45906889 missense possibly damaging 0.71
IGL02539:Ccdc180 APN 4 45921005 missense probably damaging 1.00
IGL02982:Ccdc180 APN 4 45903840 splice site probably benign
IGL03071:Ccdc180 APN 4 45903840 splice site probably benign
IGL03146:Ccdc180 APN 4 45903840 splice site probably benign
PIT4687001:Ccdc180 UTSW 4 45949526 missense probably damaging 1.00
R0049:Ccdc180 UTSW 4 45930119 critical splice acceptor site probably null
R0049:Ccdc180 UTSW 4 45930119 critical splice acceptor site probably null
R0054:Ccdc180 UTSW 4 45890900 missense probably benign 0.01
R0054:Ccdc180 UTSW 4 45890900 missense probably benign 0.01
R0080:Ccdc180 UTSW 4 45896205 missense probably null 0.00
R0082:Ccdc180 UTSW 4 45896205 missense probably null 0.00
R0126:Ccdc180 UTSW 4 45912866 critical splice donor site probably null
R0276:Ccdc180 UTSW 4 45923534 missense probably damaging 1.00
R0362:Ccdc180 UTSW 4 45923551 missense probably damaging 1.00
R0380:Ccdc180 UTSW 4 45930197 critical splice donor site probably null
R0468:Ccdc180 UTSW 4 45923271 missense possibly damaging 0.87
R0539:Ccdc180 UTSW 4 45922010 missense probably damaging 0.97
R0543:Ccdc180 UTSW 4 45900041 nonsense probably null
R0546:Ccdc180 UTSW 4 45904597 missense possibly damaging 0.71
R0612:Ccdc180 UTSW 4 45927969 missense probably damaging 0.98
R0792:Ccdc180 UTSW 4 45927975 missense possibly damaging 0.92
R1056:Ccdc180 UTSW 4 45916375 missense probably benign 0.01
R1099:Ccdc180 UTSW 4 45914225 missense probably benign 0.03
R1136:Ccdc180 UTSW 4 45914589 missense probably benign 0.00
R1263:Ccdc180 UTSW 4 45903887 missense possibly damaging 0.85
R1331:Ccdc180 UTSW 4 45909359 missense possibly damaging 0.51
R1522:Ccdc180 UTSW 4 45927975 missense possibly damaging 0.92
R1819:Ccdc180 UTSW 4 45926195 missense possibly damaging 0.84
R2022:Ccdc180 UTSW 4 45944418 missense probably benign 0.18
R2056:Ccdc180 UTSW 4 45932477 missense probably benign 0.03
R2219:Ccdc180 UTSW 4 45944949 missense probably damaging 1.00
R2228:Ccdc180 UTSW 4 45948856 critical splice donor site probably null
R2229:Ccdc180 UTSW 4 45948856 critical splice donor site probably null
R2255:Ccdc180 UTSW 4 45921996 missense probably damaging 1.00
R2427:Ccdc180 UTSW 4 45929545 missense probably benign 0.03
R3001:Ccdc180 UTSW 4 45899988 missense probably benign
R3002:Ccdc180 UTSW 4 45899988 missense probably benign
R3003:Ccdc180 UTSW 4 45899988 missense probably benign
R3110:Ccdc180 UTSW 4 45900470 missense possibly damaging 0.86
R3111:Ccdc180 UTSW 4 45900470 missense possibly damaging 0.86
R3112:Ccdc180 UTSW 4 45900470 missense possibly damaging 0.86
R3898:Ccdc180 UTSW 4 45912799 missense possibly damaging 0.71
R4022:Ccdc180 UTSW 4 45904560 nonsense probably null
R4084:Ccdc180 UTSW 4 45950632 missense probably benign 0.19
R4377:Ccdc180 UTSW 4 45941877 missense probably damaging 1.00
R4595:Ccdc180 UTSW 4 45945023 missense probably damaging 0.98
R4637:Ccdc180 UTSW 4 45914443 missense probably benign
R4811:Ccdc180 UTSW 4 45928020 missense probably damaging 1.00
R4825:Ccdc180 UTSW 4 45912794 missense possibly damaging 0.93
R4858:Ccdc180 UTSW 4 45923244 missense probably damaging 1.00
R4888:Ccdc180 UTSW 4 45909308 missense probably damaging 0.98
R4940:Ccdc180 UTSW 4 45917453 missense probably damaging 0.96
R4940:Ccdc180 UTSW 4 45917508 missense probably damaging 1.00
R5042:Ccdc180 UTSW 4 45916255 missense probably damaging 0.98
R5119:Ccdc180 UTSW 4 45914603 missense possibly damaging 0.72
R5177:Ccdc180 UTSW 4 45917508 missense probably damaging 1.00
R5311:Ccdc180 UTSW 4 45917556 missense probably damaging 1.00
R5333:Ccdc180 UTSW 4 45890935 missense possibly damaging 0.53
R5448:Ccdc180 UTSW 4 45920913 missense probably damaging 1.00
R5510:Ccdc180 UTSW 4 45928046 missense probably damaging 0.96
R6018:Ccdc180 UTSW 4 45926235 missense probably damaging 1.00
R6108:Ccdc180 UTSW 4 45911389 missense possibly damaging 0.71
R6283:Ccdc180 UTSW 4 45902486 missense possibly damaging 0.85
R6483:Ccdc180 UTSW 4 45921950 missense probably benign 0.32
R6618:Ccdc180 UTSW 4 45950708 missense probably damaging 1.00
R7017:Ccdc180 UTSW 4 45940934 missense possibly damaging 0.84
R7205:Ccdc180 UTSW 4 45914588 missense probably benign
R7341:Ccdc180 UTSW 4 45898644 missense possibly damaging 0.85
R7351:Ccdc180 UTSW 4 45903887 missense possibly damaging 0.85
R7418:Ccdc180 UTSW 4 45904616 missense probably damaging 0.98
R7492:Ccdc180 UTSW 4 45930009 splice site probably null
R7573:Ccdc180 UTSW 4 45922015 missense probably benign 0.33
R7639:Ccdc180 UTSW 4 45928043 missense possibly damaging 0.93
R7792:Ccdc180 UTSW 4 45890389 critical splice donor site probably null
R7806:Ccdc180 UTSW 4 45912801 missense possibly damaging 0.85
R7812:Ccdc180 UTSW 4 45906952 critical splice donor site probably null
R7840:Ccdc180 UTSW 4 45900461 missense possibly damaging 0.71
R7842:Ccdc180 UTSW 4 45909428 missense probably benign 0.00
R8712:Ccdc180 UTSW 4 45920842 critical splice acceptor site probably null
R8818:Ccdc180 UTSW 4 45900484 missense probably benign 0.02
R8961:Ccdc180 UTSW 4 45929573 missense possibly damaging 0.74
X0017:Ccdc180 UTSW 4 45909350 missense possibly damaging 0.86
Z1176:Ccdc180 UTSW 4 45916406 missense probably damaging 1.00
Z1176:Ccdc180 UTSW 4 45920910 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTGGTCACTGCGTCCTTACAC -3'
(R):5'- AGCCACTGGGAACCCTAGCTTATC -3'

Sequencing Primer
(F):5'- aagaaaaaacaaaggaagagaaaagg -3'
(R):5'- CTGGGAACCCTAGCTTATCTGAAG -3'
Posted On2013-04-16