Incidental Mutation 'R2095:Gnl2'
ID232030
Institutional Source Beutler Lab
Gene Symbol Gnl2
Ensembl Gene ENSMUSG00000028869
Gene Nameguanine nucleotide binding protein-like 2 (nucleolar)
SynonymsNgp-1
MMRRC Submission 040099-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R2095 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location125016585-125055380 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 125034318 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 49 (R49C)
Ref Sequence ENSEMBL: ENSMUSP00000101782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030684] [ENSMUST00000106176]
Predicted Effect probably damaging
Transcript: ENSMUST00000030684
AA Change: R49C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030684
Gene: ENSMUSG00000028869
AA Change: R49C

DomainStartEndE-ValueType
Pfam:NGP1NT 43 174 1.2e-51 PFAM
SCOP:d1egaa1 178 261 8e-3 SMART
Pfam:FeoB_N 311 398 3.1e-6 PFAM
Pfam:MMR_HSR1 312 432 3.4e-13 PFAM
low complexity region 480 500 N/A INTRINSIC
low complexity region 551 579 N/A INTRINSIC
low complexity region 679 687 N/A INTRINSIC
low complexity region 700 710 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106176
AA Change: R49C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101782
Gene: ENSMUSG00000028869
AA Change: R49C

DomainStartEndE-ValueType
Pfam:NGP1NT 43 100 4.1e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136910
Meta Mutation Damage Score 0.3661 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik C A 4: 122,702,358 Y127* probably null Het
Adam33 C T 2: 131,053,709 G562D probably damaging Het
Adh1 T C 3: 138,282,796 F177L probably damaging Het
Arhgef17 T C 7: 100,881,263 T1439A probably damaging Het
Arl5c C T 11: 97,993,451 E105K probably damaging Het
Armc3 T A 2: 19,288,929 D510E possibly damaging Het
Bbx T C 16: 50,224,689 E395G possibly damaging Het
Cacna2d2 G A 9: 107,527,165 E1087K probably benign Het
Casq1 T C 1: 172,215,962 N113S probably benign Het
Cbfa2t3 A G 8: 122,634,988 S432P probably benign Het
Cd163 A G 6: 124,317,822 D615G probably damaging Het
Chrnb2 A T 3: 89,761,437 D190E probably benign Het
Clec9a T C 6: 129,416,358 L115P possibly damaging Het
Cluh C T 11: 74,661,724 R532* probably null Het
Cntnap5a T A 1: 116,442,260 L869Q probably damaging Het
Ctgf T C 10: 24,596,479 V140A probably benign Het
Cyp3a57 A T 5: 145,369,134 K143* probably null Het
Dcaf12 G T 4: 41,294,085 H351N probably benign Het
Dtna T A 18: 23,569,748 L112Q probably damaging Het
Fnta G A 8: 25,999,879 Q303* probably null Het
Frs2 T C 10: 117,074,602 E285G probably benign Het
Gabra4 T C 5: 71,624,112 I293V probably damaging Het
Gm2431 A T 7: 142,257,781 C129S unknown Het
Helz T A 11: 107,646,146 Y275N probably damaging Het
Hydin A G 8: 110,462,657 E1231G probably damaging Het
Kctd11 T A 11: 69,879,576 D212V probably damaging Het
Klf3 T A 5: 64,821,902 M29K probably benign Het
Klhl21 T C 4: 152,009,393 S151P probably benign Het
Lsm14b A T 2: 180,031,787 probably benign Het
Mlxipl T C 5: 135,122,120 probably benign Het
Mov10 G A 3: 104,801,531 R389C probably damaging Het
Msh6 A G 17: 87,988,233 M1071V possibly damaging Het
Myh8 G T 11: 67,286,224 A401S probably benign Het
Ndufv3 T C 17: 31,527,486 S117P possibly damaging Het
Obscn A T 11: 59,093,584 probably null Het
Olfr1205 T C 2: 88,831,290 Y58H probably damaging Het
Olfr150 T A 9: 39,737,261 Y149N probably damaging Het
Olfr166 T C 16: 19,486,931 I31T probably benign Het
Olfr381 T A 11: 73,486,594 T77S probably damaging Het
Pcdhb17 T A 18: 37,486,322 D388E probably benign Het
Pgm3 T C 9: 86,556,341 T423A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
S1pr5 T A 9: 21,244,858 T91S probably benign Het
Sgcz T C 8: 37,540,392 probably benign Het
Slc33a1 A G 3: 63,963,955 L79P probably damaging Het
Slco2a1 A G 9: 103,076,968 T383A probably benign Het
Slit1 G A 19: 41,606,380 R1184W probably damaging Het
Spta1 T A 1: 174,244,198 M2248K possibly damaging Het
Stub1 A G 17: 25,830,890 Y304H probably damaging Het
Taar7e T A 10: 24,038,051 Y146* probably null Het
Tbc1d1 C T 5: 64,316,501 S660L probably benign Het
Tcea2 C A 2: 181,686,932 F259L probably damaging Het
Tcp11l1 T A 2: 104,681,840 K482N probably damaging Het
Trpv6 C T 6: 41,621,756 R645Q probably damaging Het
Uaca T A 9: 60,840,843 S30T probably benign Het
Ubap2 C G 4: 41,206,901 V492L possibly damaging Het
Ube3c T C 5: 29,668,040 F1026S probably damaging Het
Vmn2r8 T G 5: 108,808,621 D45A possibly damaging Het
Zfp738 G T 13: 67,671,303 L180I probably damaging Het
Other mutations in Gnl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01977:Gnl2 APN 4 125047612 splice site probably null
IGL02536:Gnl2 APN 4 125052608 nonsense probably null
IGL03358:Gnl2 APN 4 125052594 missense probably damaging 1.00
PIT4283001:Gnl2 UTSW 4 125046306 missense probably damaging 1.00
R0377:Gnl2 UTSW 4 125046382 splice site probably benign
R0419:Gnl2 UTSW 4 125053527 missense probably benign 0.00
R0975:Gnl2 UTSW 4 125048378 missense probably damaging 0.99
R1529:Gnl2 UTSW 4 125046306 missense probably damaging 1.00
R1550:Gnl2 UTSW 4 125044234 missense probably damaging 1.00
R1942:Gnl2 UTSW 4 125030164 missense probably benign 0.01
R2125:Gnl2 UTSW 4 125053485 missense probably benign 0.01
R3712:Gnl2 UTSW 4 125046274 missense probably damaging 0.98
R3781:Gnl2 UTSW 4 125037606 missense probably damaging 0.99
R4656:Gnl2 UTSW 4 125040997 nonsense probably null
R4676:Gnl2 UTSW 4 125053473 missense possibly damaging 0.83
R4710:Gnl2 UTSW 4 125053459 missense probably benign 0.01
R4734:Gnl2 UTSW 4 125041018 missense probably benign
R4916:Gnl2 UTSW 4 125043692 missense probably damaging 1.00
R5106:Gnl2 UTSW 4 125053536 critical splice donor site probably null
R5310:Gnl2 UTSW 4 125052840 missense probably benign 0.00
R5506:Gnl2 UTSW 4 125055365 utr 3 prime probably benign
R5967:Gnl2 UTSW 4 125041030 missense probably benign 0.00
R6184:Gnl2 UTSW 4 125054229 critical splice donor site probably null
R6395:Gnl2 UTSW 4 125046265 missense probably damaging 0.99
R6432:Gnl2 UTSW 4 125052560 missense possibly damaging 0.86
R6672:Gnl2 UTSW 4 125048393 missense probably damaging 1.00
R7657:Gnl2 UTSW 4 125030158 missense probably benign 0.00
RF003:Gnl2 UTSW 4 125043725 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTGGCTAGTTGGGTAAGCAC -3'
(R):5'- TAGCTGGGATCTGACACTACAG -3'

Sequencing Primer
(F):5'- GCACTTGGTTAGCACATTTTAAAC -3'
(R):5'- CCACTTGCCAGGAAGTGTTAG -3'
Posted On2014-09-18