Incidental Mutation 'R2095:Vmn2r8'
ID232035
Institutional Source Beutler Lab
Gene Symbol Vmn2r8
Ensembl Gene ENSMUSG00000090961
Gene Namevomeronasal 2, receptor 8
SynonymsEG627479
MMRRC Submission 040099-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R2095 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location108797193-108808754 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 108808621 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 45 (D45A)
Ref Sequence ENSEMBL: ENSMUSP00000126953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172140]
Predicted Effect possibly damaging
Transcript: ENSMUST00000172140
AA Change: D45A

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126953
Gene: ENSMUSG00000090961
AA Change: D45A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 78 419 1.1e-28 PFAM
Pfam:NCD3G 507 561 8.2e-18 PFAM
Pfam:7tm_3 594 829 1.1e-54 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik C A 4: 122,702,358 Y127* probably null Het
Adam33 C T 2: 131,053,709 G562D probably damaging Het
Adh1 T C 3: 138,282,796 F177L probably damaging Het
Arhgef17 T C 7: 100,881,263 T1439A probably damaging Het
Arl5c C T 11: 97,993,451 E105K probably damaging Het
Armc3 T A 2: 19,288,929 D510E possibly damaging Het
Bbx T C 16: 50,224,689 E395G possibly damaging Het
Cacna2d2 G A 9: 107,527,165 E1087K probably benign Het
Casq1 T C 1: 172,215,962 N113S probably benign Het
Cbfa2t3 A G 8: 122,634,988 S432P probably benign Het
Cd163 A G 6: 124,317,822 D615G probably damaging Het
Chrnb2 A T 3: 89,761,437 D190E probably benign Het
Clec9a T C 6: 129,416,358 L115P possibly damaging Het
Cluh C T 11: 74,661,724 R532* probably null Het
Cntnap5a T A 1: 116,442,260 L869Q probably damaging Het
Ctgf T C 10: 24,596,479 V140A probably benign Het
Cyp3a57 A T 5: 145,369,134 K143* probably null Het
Dcaf12 G T 4: 41,294,085 H351N probably benign Het
Dtna T A 18: 23,569,748 L112Q probably damaging Het
Fnta G A 8: 25,999,879 Q303* probably null Het
Frs2 T C 10: 117,074,602 E285G probably benign Het
Gabra4 T C 5: 71,624,112 I293V probably damaging Het
Gm2431 A T 7: 142,257,781 C129S unknown Het
Gnl2 C T 4: 125,034,318 R49C probably damaging Het
Helz T A 11: 107,646,146 Y275N probably damaging Het
Hydin A G 8: 110,462,657 E1231G probably damaging Het
Kctd11 T A 11: 69,879,576 D212V probably damaging Het
Klf3 T A 5: 64,821,902 M29K probably benign Het
Klhl21 T C 4: 152,009,393 S151P probably benign Het
Lsm14b A T 2: 180,031,787 probably benign Het
Mlxipl T C 5: 135,122,120 probably benign Het
Mov10 G A 3: 104,801,531 R389C probably damaging Het
Msh6 A G 17: 87,988,233 M1071V possibly damaging Het
Myh8 G T 11: 67,286,224 A401S probably benign Het
Ndufv3 T C 17: 31,527,486 S117P possibly damaging Het
Obscn A T 11: 59,093,584 probably null Het
Olfr1205 T C 2: 88,831,290 Y58H probably damaging Het
Olfr150 T A 9: 39,737,261 Y149N probably damaging Het
Olfr166 T C 16: 19,486,931 I31T probably benign Het
Olfr381 T A 11: 73,486,594 T77S probably damaging Het
Pcdhb17 T A 18: 37,486,322 D388E probably benign Het
Pgm3 T C 9: 86,556,341 T423A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
S1pr5 T A 9: 21,244,858 T91S probably benign Het
Sgcz T C 8: 37,540,392 probably benign Het
Slc33a1 A G 3: 63,963,955 L79P probably damaging Het
Slco2a1 A G 9: 103,076,968 T383A probably benign Het
Slit1 G A 19: 41,606,380 R1184W probably damaging Het
Spta1 T A 1: 174,244,198 M2248K possibly damaging Het
Stub1 A G 17: 25,830,890 Y304H probably damaging Het
Taar7e T A 10: 24,038,051 Y146* probably null Het
Tbc1d1 C T 5: 64,316,501 S660L probably benign Het
Tcea2 C A 2: 181,686,932 F259L probably damaging Het
Tcp11l1 T A 2: 104,681,840 K482N probably damaging Het
Trpv6 C T 6: 41,621,756 R645Q probably damaging Het
Uaca T A 9: 60,840,843 S30T probably benign Het
Ubap2 C G 4: 41,206,901 V492L possibly damaging Het
Ube3c T C 5: 29,668,040 F1026S probably damaging Het
Zfp738 G T 13: 67,671,303 L180I probably damaging Het
Other mutations in Vmn2r8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02957:Vmn2r8 APN 5 108802225 missense probably benign 0.01
R0324:Vmn2r8 UTSW 5 108797941 unclassified probably null
R0335:Vmn2r8 UTSW 5 108797451 unclassified probably null
R0394:Vmn2r8 UTSW 5 108802072 missense probably benign 0.12
R0501:Vmn2r8 UTSW 5 108803183 missense probably benign 0.03
R0615:Vmn2r8 UTSW 5 108799329 missense probably damaging 1.00
R0678:Vmn2r8 UTSW 5 108800546 missense probably benign 0.00
R1167:Vmn2r8 UTSW 5 108803176 missense probably benign 0.01
R1187:Vmn2r8 UTSW 5 108803219 nonsense probably null
R1406:Vmn2r8 UTSW 5 108802368 missense probably benign
R1406:Vmn2r8 UTSW 5 108802368 missense probably benign
R1451:Vmn2r8 UTSW 5 108798067 missense probably damaging 1.00
R1535:Vmn2r8 UTSW 5 108802174 missense probably damaging 1.00
R1795:Vmn2r8 UTSW 5 108803106 missense probably benign
R1874:Vmn2r8 UTSW 5 108802418 missense possibly damaging 0.74
R1908:Vmn2r8 UTSW 5 108797570 missense probably benign 0.03
R1925:Vmn2r8 UTSW 5 108802153 missense probably damaging 0.97
R1960:Vmn2r8 UTSW 5 108799286 missense probably damaging 0.99
R1961:Vmn2r8 UTSW 5 108798095 missense probably benign 0.45
R1967:Vmn2r8 UTSW 5 108802383 missense probably benign 0.01
R2159:Vmn2r8 UTSW 5 108802303 missense probably benign 0.22
R4240:Vmn2r8 UTSW 5 108797503 missense probably damaging 0.99
R4581:Vmn2r8 UTSW 5 108801704 missense probably benign 0.03
R4744:Vmn2r8 UTSW 5 108808581 missense probably benign 0.00
R4755:Vmn2r8 UTSW 5 108801700 missense probably benign 0.03
R4917:Vmn2r8 UTSW 5 108797398 missense probably damaging 1.00
R4957:Vmn2r8 UTSW 5 108799263 missense probably benign 0.16
R5141:Vmn2r8 UTSW 5 108808706 missense probably damaging 0.96
R5481:Vmn2r8 UTSW 5 108801770 missense probably benign 0.09
R5571:Vmn2r8 UTSW 5 108802240 missense probably damaging 1.00
R5624:Vmn2r8 UTSW 5 108802459 missense probably damaging 0.99
R6003:Vmn2r8 UTSW 5 108797382 missense probably damaging 1.00
R6243:Vmn2r8 UTSW 5 108799345 missense probably benign 0.01
R6265:Vmn2r8 UTSW 5 108808597 missense probably benign
R6315:Vmn2r8 UTSW 5 108801891 missense probably benign
R6413:Vmn2r8 UTSW 5 108801723 missense probably benign 0.09
R7120:Vmn2r8 UTSW 5 108808638 missense possibly damaging 0.56
R7406:Vmn2r8 UTSW 5 108800576 missense probably benign 0.00
R7409:Vmn2r8 UTSW 5 108808583 nonsense probably null
R7489:Vmn2r8 UTSW 5 108797656 missense possibly damaging 0.95
R7532:Vmn2r8 UTSW 5 108802240 missense probably benign 0.22
R7534:Vmn2r8 UTSW 5 108802174 missense possibly damaging 0.94
R7739:Vmn2r8 UTSW 5 108802177 missense probably damaging 1.00
Z1088:Vmn2r8 UTSW 5 108801998 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTGGCATTGTGAACTGGAATC -3'
(R):5'- TGCAGAAGAAACGGATTTCAC -3'

Sequencing Primer
(F):5'- GCATTGTGAACTGGAATCCATTG -3'
(R):5'- GGATTTCACAACTACTCCATCTTAG -3'
Posted On2014-09-18