Incidental Mutation 'R2095:Fnta'
ID232045
Institutional Source Beutler Lab
Gene Symbol Fnta
Ensembl Gene ENSMUSG00000015994
Gene Namefarnesyltransferase, CAAX box, alpha
SynonymsFTA
MMRRC Submission 040099-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2095 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location25998722-26015650 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 25999879 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 303 (Q303*)
Ref Sequence ENSEMBL: ENSMUSP00000016138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016138]
PDB Structure
Crystal structure of FTase(ALPHA-subunit; BETA-subunit DELTA C10) in complex with BMS3 and lipid substrate FPP [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000016138
AA Change: Q303*
SMART Domains Protein: ENSMUSP00000016138
Gene: ENSMUSG00000015994
AA Change: Q303*

DomainStartEndE-ValueType
low complexity region 11 48 N/A INTRINSIC
Pfam:PPTA 116 143 4.6e-11 PFAM
Pfam:PPTA 151 178 9.2e-14 PFAM
Pfam:PPTA 185 212 3.9e-15 PFAM
Pfam:PPTA 219 246 8.1e-11 PFAM
Pfam:PPTA 259 285 4.7e-9 PFAM
low complexity region 293 304 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209860
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211718
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Prenyltransferases can attach either a farnesyl group or a geranylgeranyl group in thioether linkage to the cysteine residue of proteins with a C-terminal CAAX box. CAAX geranylgeranyltransferase and CAAX farnesyltransferase are heterodimers that share the same alpha subunit but have different beta subunits. This gene encodes the alpha subunit of these transferases. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 11 and 13. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik C A 4: 122,702,358 Y127* probably null Het
Adam33 C T 2: 131,053,709 G562D probably damaging Het
Adh1 T C 3: 138,282,796 F177L probably damaging Het
Arhgef17 T C 7: 100,881,263 T1439A probably damaging Het
Arl5c C T 11: 97,993,451 E105K probably damaging Het
Armc3 T A 2: 19,288,929 D510E possibly damaging Het
Bbx T C 16: 50,224,689 E395G possibly damaging Het
Cacna2d2 G A 9: 107,527,165 E1087K probably benign Het
Casq1 T C 1: 172,215,962 N113S probably benign Het
Cbfa2t3 A G 8: 122,634,988 S432P probably benign Het
Cd163 A G 6: 124,317,822 D615G probably damaging Het
Chrnb2 A T 3: 89,761,437 D190E probably benign Het
Clec9a T C 6: 129,416,358 L115P possibly damaging Het
Cluh C T 11: 74,661,724 R532* probably null Het
Cntnap5a T A 1: 116,442,260 L869Q probably damaging Het
Ctgf T C 10: 24,596,479 V140A probably benign Het
Cyp3a57 A T 5: 145,369,134 K143* probably null Het
Dcaf12 G T 4: 41,294,085 H351N probably benign Het
Dtna T A 18: 23,569,748 L112Q probably damaging Het
Frs2 T C 10: 117,074,602 E285G probably benign Het
Gabra4 T C 5: 71,624,112 I293V probably damaging Het
Gm2431 A T 7: 142,257,781 C129S unknown Het
Gnl2 C T 4: 125,034,318 R49C probably damaging Het
Helz T A 11: 107,646,146 Y275N probably damaging Het
Hydin A G 8: 110,462,657 E1231G probably damaging Het
Kctd11 T A 11: 69,879,576 D212V probably damaging Het
Klf3 T A 5: 64,821,902 M29K probably benign Het
Klhl21 T C 4: 152,009,393 S151P probably benign Het
Lsm14b A T 2: 180,031,787 probably benign Het
Mlxipl T C 5: 135,122,120 probably benign Het
Mov10 G A 3: 104,801,531 R389C probably damaging Het
Msh6 A G 17: 87,988,233 M1071V possibly damaging Het
Myh8 G T 11: 67,286,224 A401S probably benign Het
Ndufv3 T C 17: 31,527,486 S117P possibly damaging Het
Obscn A T 11: 59,093,584 probably null Het
Olfr1205 T C 2: 88,831,290 Y58H probably damaging Het
Olfr150 T A 9: 39,737,261 Y149N probably damaging Het
Olfr166 T C 16: 19,486,931 I31T probably benign Het
Olfr381 T A 11: 73,486,594 T77S probably damaging Het
Pcdhb17 T A 18: 37,486,322 D388E probably benign Het
Pgm3 T C 9: 86,556,341 T423A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
S1pr5 T A 9: 21,244,858 T91S probably benign Het
Sgcz T C 8: 37,540,392 probably benign Het
Slc33a1 A G 3: 63,963,955 L79P probably damaging Het
Slco2a1 A G 9: 103,076,968 T383A probably benign Het
Slit1 G A 19: 41,606,380 R1184W probably damaging Het
Spta1 T A 1: 174,244,198 M2248K possibly damaging Het
Stub1 A G 17: 25,830,890 Y304H probably damaging Het
Taar7e T A 10: 24,038,051 Y146* probably null Het
Tbc1d1 C T 5: 64,316,501 S660L probably benign Het
Tcea2 C A 2: 181,686,932 F259L probably damaging Het
Tcp11l1 T A 2: 104,681,840 K482N probably damaging Het
Trpv6 C T 6: 41,621,756 R645Q probably damaging Het
Uaca T A 9: 60,840,843 S30T probably benign Het
Ubap2 C G 4: 41,206,901 V492L possibly damaging Het
Ube3c T C 5: 29,668,040 F1026S probably damaging Het
Vmn2r8 T G 5: 108,808,621 D45A possibly damaging Het
Zfp738 G T 13: 67,671,303 L180I probably damaging Het
Other mutations in Fnta
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Fnta APN 8 26007201 nonsense probably null
IGL01508:Fnta APN 8 26007266 missense probably damaging 1.00
R0455:Fnta UTSW 8 26001028 missense probably benign 0.00
R1462:Fnta UTSW 8 25999571 splice site probably null
R1462:Fnta UTSW 8 25999571 splice site probably null
R1772:Fnta UTSW 8 26000966 splice site probably benign
R2174:Fnta UTSW 8 26013470 missense possibly damaging 0.95
R5193:Fnta UTSW 8 26011218 splice site probably null
R5212:Fnta UTSW 8 26009707 missense probably benign 0.07
R5557:Fnta UTSW 8 25999536 missense probably damaging 1.00
R5756:Fnta UTSW 8 26009707 missense possibly damaging 0.94
R6467:Fnta UTSW 8 26007313 nonsense probably null
R7127:Fnta UTSW 8 26007203 missense probably damaging 1.00
R7571:Fnta UTSW 8 26015465 missense probably benign 0.02
R7644:Fnta UTSW 8 26013488 missense probably damaging 0.97
R8012:Fnta UTSW 8 25999507 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGAGCCCTGAGAAACTCCATG -3'
(R):5'- GGCCCACACAGTTTAAAATAAGTTC -3'

Sequencing Primer
(F):5'- CCCTGAGAAACTCCATGAGGTATG -3'
(R):5'- AAATAAGTTCTTCTTTCTTTTCCCGC -3'
Posted On2014-09-18