Incidental Mutation 'R2095:Cbfa2t3'
ID232048
Institutional Source Beutler Lab
Gene Symbol Cbfa2t3
Ensembl Gene ENSMUSG00000006362
Gene Namecore-binding factor, runt domain, alpha subunit 2, translocated to, 3 (human)
SynonymsMTGR2, ETO-2, Eto2, A630044F12Rik
MMRRC Submission 040099-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2095 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location122625141-122699109 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122634988 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 432 (S432P)
Ref Sequence ENSEMBL: ENSMUSP00000118997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006525] [ENSMUST00000064674] [ENSMUST00000127664] [ENSMUST00000127984] [ENSMUST00000134045]
Predicted Effect probably benign
Transcript: ENSMUST00000006525
AA Change: S371P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000006525
Gene: ENSMUSG00000006362
AA Change: S371P

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
TAFH 87 177 5.46e-52 SMART
low complexity region 248 257 N/A INTRINSIC
Pfam:NHR2 295 361 3.6e-41 PFAM
PDB:2KYG|C 395 424 3e-10 PDB
Pfam:zf-MYND 472 508 2.6e-10 PFAM
low complexity region 529 552 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064674
AA Change: S397P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000065728
Gene: ENSMUSG00000006362
AA Change: S397P

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
TAFH 113 203 5.46e-52 SMART
low complexity region 274 283 N/A INTRINSIC
Pfam:NHR2 321 387 7.1e-41 PFAM
PDB:2KYG|C 421 450 1e-10 PDB
Pfam:zf-MYND 498 534 7.1e-10 PFAM
low complexity region 555 578 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127984
AA Change: S432P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118997
Gene: ENSMUSG00000006362
AA Change: S432P

DomainStartEndE-ValueType
low complexity region 47 62 N/A INTRINSIC
TAFH 148 238 5.46e-52 SMART
low complexity region 309 318 N/A INTRINSIC
Pfam:NHR2 356 422 2.3e-38 PFAM
PDB:2KYG|C 456 485 2e-10 PDB
Pfam:zf-MYND 533 569 6.9e-10 PFAM
low complexity region 590 613 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134045
SMART Domains Protein: ENSMUSP00000117630
Gene: ENSMUSG00000006362

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
Pfam:TAFH 111 185 3.7e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142535
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myeloid translocation gene family which interact with DNA-bound transcription factors and recruit a range of corepressors to facilitate transcriptional repression. The t(16;21)(q24;q22) translocation is one of the less common karyotypic abnormalities in acute myeloid leukemia. The translocation produces a chimeric gene made up of the 5'-region of the runt-related transcription factor 1 gene fused to the 3'-region of this gene. This gene is also a putative breast tumor suppressor. Alternative splicing results in transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice that are homozygote null for this gene display skewing of the early myeloid progenitor cells toward the granulocytic/macrophage lineage while reducing the numbers of megakaryocyte-erythroid progenitor cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik C A 4: 122,702,358 Y127* probably null Het
Adam33 C T 2: 131,053,709 G562D probably damaging Het
Adh1 T C 3: 138,282,796 F177L probably damaging Het
Arhgef17 T C 7: 100,881,263 T1439A probably damaging Het
Arl5c C T 11: 97,993,451 E105K probably damaging Het
Armc3 T A 2: 19,288,929 D510E possibly damaging Het
Bbx T C 16: 50,224,689 E395G possibly damaging Het
Cacna2d2 G A 9: 107,527,165 E1087K probably benign Het
Casq1 T C 1: 172,215,962 N113S probably benign Het
Cd163 A G 6: 124,317,822 D615G probably damaging Het
Chrnb2 A T 3: 89,761,437 D190E probably benign Het
Clec9a T C 6: 129,416,358 L115P possibly damaging Het
Cluh C T 11: 74,661,724 R532* probably null Het
Cntnap5a T A 1: 116,442,260 L869Q probably damaging Het
Ctgf T C 10: 24,596,479 V140A probably benign Het
Cyp3a57 A T 5: 145,369,134 K143* probably null Het
Dcaf12 G T 4: 41,294,085 H351N probably benign Het
Dtna T A 18: 23,569,748 L112Q probably damaging Het
Fnta G A 8: 25,999,879 Q303* probably null Het
Frs2 T C 10: 117,074,602 E285G probably benign Het
Gabra4 T C 5: 71,624,112 I293V probably damaging Het
Gm2431 A T 7: 142,257,781 C129S unknown Het
Gnl2 C T 4: 125,034,318 R49C probably damaging Het
Helz T A 11: 107,646,146 Y275N probably damaging Het
Hydin A G 8: 110,462,657 E1231G probably damaging Het
Kctd11 T A 11: 69,879,576 D212V probably damaging Het
Klf3 T A 5: 64,821,902 M29K probably benign Het
Klhl21 T C 4: 152,009,393 S151P probably benign Het
Lsm14b A T 2: 180,031,787 probably benign Het
Mlxipl T C 5: 135,122,120 probably benign Het
Mov10 G A 3: 104,801,531 R389C probably damaging Het
Msh6 A G 17: 87,988,233 M1071V possibly damaging Het
Myh8 G T 11: 67,286,224 A401S probably benign Het
Ndufv3 T C 17: 31,527,486 S117P possibly damaging Het
Obscn A T 11: 59,093,584 probably null Het
Olfr1205 T C 2: 88,831,290 Y58H probably damaging Het
Olfr150 T A 9: 39,737,261 Y149N probably damaging Het
Olfr166 T C 16: 19,486,931 I31T probably benign Het
Olfr381 T A 11: 73,486,594 T77S probably damaging Het
Pcdhb17 T A 18: 37,486,322 D388E probably benign Het
Pgm3 T C 9: 86,556,341 T423A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
S1pr5 T A 9: 21,244,858 T91S probably benign Het
Sgcz T C 8: 37,540,392 probably benign Het
Slc33a1 A G 3: 63,963,955 L79P probably damaging Het
Slco2a1 A G 9: 103,076,968 T383A probably benign Het
Slit1 G A 19: 41,606,380 R1184W probably damaging Het
Spta1 T A 1: 174,244,198 M2248K possibly damaging Het
Stub1 A G 17: 25,830,890 Y304H probably damaging Het
Taar7e T A 10: 24,038,051 Y146* probably null Het
Tbc1d1 C T 5: 64,316,501 S660L probably benign Het
Tcea2 C A 2: 181,686,932 F259L probably damaging Het
Tcp11l1 T A 2: 104,681,840 K482N probably damaging Het
Trpv6 C T 6: 41,621,756 R645Q probably damaging Het
Uaca T A 9: 60,840,843 S30T probably benign Het
Ubap2 C G 4: 41,206,901 V492L possibly damaging Het
Ube3c T C 5: 29,668,040 F1026S probably damaging Het
Vmn2r8 T G 5: 108,808,621 D45A possibly damaging Het
Zfp738 G T 13: 67,671,303 L180I probably damaging Het
Other mutations in Cbfa2t3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02095:Cbfa2t3 APN 8 122633493 missense probably damaging 1.00
IGL02578:Cbfa2t3 APN 8 122633448 missense possibly damaging 0.83
IGL02934:Cbfa2t3 APN 8 122647758 missense probably benign 0.03
IGL03089:Cbfa2t3 APN 8 122635134 missense probably damaging 1.00
R0196:Cbfa2t3 UTSW 8 122633337 missense possibly damaging 0.77
R0365:Cbfa2t3 UTSW 8 122635060 missense probably benign 0.23
R0395:Cbfa2t3 UTSW 8 122638951 missense probably benign 0.09
R0784:Cbfa2t3 UTSW 8 122650487 splice site probably benign
R0835:Cbfa2t3 UTSW 8 122647778 missense probably benign 0.00
R1608:Cbfa2t3 UTSW 8 122647709 missense probably damaging 0.99
R2008:Cbfa2t3 UTSW 8 122643293 missense probably damaging 0.99
R2088:Cbfa2t3 UTSW 8 122637986 unclassified probably benign
R4079:Cbfa2t3 UTSW 8 122647695 splice site probably null
R4175:Cbfa2t3 UTSW 8 122643318 missense probably damaging 1.00
R5013:Cbfa2t3 UTSW 8 122638859 missense possibly damaging 0.95
R5141:Cbfa2t3 UTSW 8 122635021 missense probably benign 0.24
R5391:Cbfa2t3 UTSW 8 122633395 nonsense probably null
R6067:Cbfa2t3 UTSW 8 122643497 missense probably benign 0.00
R6078:Cbfa2t3 UTSW 8 122643497 missense probably benign 0.00
R6192:Cbfa2t3 UTSW 8 122634396 missense probably benign 0.00
R6281:Cbfa2t3 UTSW 8 122633409 missense probably damaging 1.00
R6520:Cbfa2t3 UTSW 8 122635801 missense probably benign 0.02
R6936:Cbfa2t3 UTSW 8 122647739 missense probably damaging 0.97
R7154:Cbfa2t3 UTSW 8 122638144 nonsense probably null
R7196:Cbfa2t3 UTSW 8 122638990 missense probably benign 0.26
R7295:Cbfa2t3 UTSW 8 122638029 missense probably benign 0.02
R7514:Cbfa2t3 UTSW 8 122635126 missense probably damaging 1.00
R7616:Cbfa2t3 UTSW 8 122633337 missense possibly damaging 0.87
R8070:Cbfa2t3 UTSW 8 122642981 missense possibly damaging 0.81
U15987:Cbfa2t3 UTSW 8 122643497 missense probably benign 0.00
Z1176:Cbfa2t3 UTSW 8 122698895 start gained probably benign
Z1177:Cbfa2t3 UTSW 8 122630757 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAAGTGAGGCTTCCTGTTTAAG -3'
(R):5'- GTATAGATTTCTGTGCCCCGC -3'

Sequencing Primer
(F):5'- AGGCTTCCTGTTTAAGTAAGGACC -3'
(R):5'- TTCCAACGTCCTGAAGGC -3'
Posted On2014-09-18