Incidental Mutation 'R2095:Olfr166'
ID232071
Institutional Source Beutler Lab
Gene Symbol Olfr166
Ensembl Gene ENSMUSG00000056822
Gene Nameolfactory receptor 166
SynonymsGA_x54KRFPKG5P-15934912-15935850, MOR270-1
MMRRC Submission 040099-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R2095 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location19483694-19489882 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19486931 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 31 (I31T)
Ref Sequence ENSEMBL: ENSMUSP00000150764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074739] [ENSMUST00000213531] [ENSMUST00000216465]
Predicted Effect probably benign
Transcript: ENSMUST00000074739
AA Change: I31T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074299
Gene: ENSMUSG00000056822
AA Change: I31T

DomainStartEndE-ValueType
low complexity region 12 29 N/A INTRINSIC
Pfam:7tm_4 30 306 4e-50 PFAM
Pfam:7TM_GPCR_Srsx 33 295 3.6e-7 PFAM
Pfam:7tm_1 40 289 2.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213531
AA Change: I31T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216465
AA Change: I31T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.1082 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik C A 4: 122,702,358 Y127* probably null Het
Adam33 C T 2: 131,053,709 G562D probably damaging Het
Adh1 T C 3: 138,282,796 F177L probably damaging Het
Arhgef17 T C 7: 100,881,263 T1439A probably damaging Het
Arl5c C T 11: 97,993,451 E105K probably damaging Het
Armc3 T A 2: 19,288,929 D510E possibly damaging Het
Bbx T C 16: 50,224,689 E395G possibly damaging Het
Cacna2d2 G A 9: 107,527,165 E1087K probably benign Het
Casq1 T C 1: 172,215,962 N113S probably benign Het
Cbfa2t3 A G 8: 122,634,988 S432P probably benign Het
Cd163 A G 6: 124,317,822 D615G probably damaging Het
Chrnb2 A T 3: 89,761,437 D190E probably benign Het
Clec9a T C 6: 129,416,358 L115P possibly damaging Het
Cluh C T 11: 74,661,724 R532* probably null Het
Cntnap5a T A 1: 116,442,260 L869Q probably damaging Het
Ctgf T C 10: 24,596,479 V140A probably benign Het
Cyp3a57 A T 5: 145,369,134 K143* probably null Het
Dcaf12 G T 4: 41,294,085 H351N probably benign Het
Dtna T A 18: 23,569,748 L112Q probably damaging Het
Fnta G A 8: 25,999,879 Q303* probably null Het
Frs2 T C 10: 117,074,602 E285G probably benign Het
Gabra4 T C 5: 71,624,112 I293V probably damaging Het
Gm2431 A T 7: 142,257,781 C129S unknown Het
Gnl2 C T 4: 125,034,318 R49C probably damaging Het
Helz T A 11: 107,646,146 Y275N probably damaging Het
Hydin A G 8: 110,462,657 E1231G probably damaging Het
Kctd11 T A 11: 69,879,576 D212V probably damaging Het
Klf3 T A 5: 64,821,902 M29K probably benign Het
Klhl21 T C 4: 152,009,393 S151P probably benign Het
Lsm14b A T 2: 180,031,787 probably benign Het
Mlxipl T C 5: 135,122,120 probably benign Het
Mov10 G A 3: 104,801,531 R389C probably damaging Het
Msh6 A G 17: 87,988,233 M1071V possibly damaging Het
Myh8 G T 11: 67,286,224 A401S probably benign Het
Ndufv3 T C 17: 31,527,486 S117P possibly damaging Het
Obscn A T 11: 59,093,584 probably null Het
Olfr1205 T C 2: 88,831,290 Y58H probably damaging Het
Olfr150 T A 9: 39,737,261 Y149N probably damaging Het
Olfr381 T A 11: 73,486,594 T77S probably damaging Het
Pcdhb17 T A 18: 37,486,322 D388E probably benign Het
Pgm3 T C 9: 86,556,341 T423A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
S1pr5 T A 9: 21,244,858 T91S probably benign Het
Sgcz T C 8: 37,540,392 probably benign Het
Slc33a1 A G 3: 63,963,955 L79P probably damaging Het
Slco2a1 A G 9: 103,076,968 T383A probably benign Het
Slit1 G A 19: 41,606,380 R1184W probably damaging Het
Spta1 T A 1: 174,244,198 M2248K possibly damaging Het
Stub1 A G 17: 25,830,890 Y304H probably damaging Het
Taar7e T A 10: 24,038,051 Y146* probably null Het
Tbc1d1 C T 5: 64,316,501 S660L probably benign Het
Tcea2 C A 2: 181,686,932 F259L probably damaging Het
Tcp11l1 T A 2: 104,681,840 K482N probably damaging Het
Trpv6 C T 6: 41,621,756 R645Q probably damaging Het
Uaca T A 9: 60,840,843 S30T probably benign Het
Ubap2 C G 4: 41,206,901 V492L possibly damaging Het
Ube3c T C 5: 29,668,040 F1026S probably damaging Het
Vmn2r8 T G 5: 108,808,621 D45A possibly damaging Het
Zfp738 G T 13: 67,671,303 L180I probably damaging Het
Other mutations in Olfr166
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01559:Olfr166 APN 16 19487459 missense probably benign 0.13
IGL01639:Olfr166 APN 16 19487164 missense probably damaging 0.97
IGL02105:Olfr166 APN 16 19487261 missense probably benign 0.15
IGL02352:Olfr166 APN 16 19487177 missense probably damaging 1.00
IGL02359:Olfr166 APN 16 19487177 missense probably damaging 1.00
IGL03053:Olfr166 APN 16 19487219 missense probably benign 0.36
IGL03168:Olfr166 APN 16 19487219 missense probably benign 0.36
R0576:Olfr166 UTSW 16 19487188 missense probably damaging 1.00
R0920:Olfr166 UTSW 16 19486930 missense probably benign 0.00
R1335:Olfr166 UTSW 16 19487053 missense probably benign 0.01
R1468:Olfr166 UTSW 16 19487628 missense probably benign 0.15
R1468:Olfr166 UTSW 16 19487628 missense probably benign 0.15
R1490:Olfr166 UTSW 16 19486922 missense probably benign
R3123:Olfr166 UTSW 16 19487015 missense probably damaging 1.00
R4893:Olfr166 UTSW 16 19486903 missense probably benign
R5093:Olfr166 UTSW 16 19487477 missense probably damaging 1.00
R5222:Olfr166 UTSW 16 19486930 missense probably benign
R7149:Olfr166 UTSW 16 19487510 missense probably damaging 1.00
R7305:Olfr166 UTSW 16 19487699 missense probably damaging 0.98
R7484:Olfr166 UTSW 16 19487003 missense possibly damaging 0.82
X0020:Olfr166 UTSW 16 19487090 missense probably benign 0.22
Z1088:Olfr166 UTSW 16 19487048 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- CATTTCAGTACAAGTGAGTTCCTC -3'
(R):5'- AGAAGGATTGCACTCCACAG -3'

Sequencing Primer
(F):5'- CAGTACAAGTGAGTTCCTCTTTATTC -3'
(R):5'- AAAGAGATGCTTTTCTGGCCAG -3'
Posted On2014-09-18