Incidental Mutation 'R2096:Cenpf'
ID232083
Institutional Source Beutler Lab
Gene Symbol Cenpf
Ensembl Gene ENSMUSG00000026605
Gene Namecentromere protein F
Synonymsmitosin, 6530404A22Rik, Lek1
MMRRC Submission 040100-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.680) question?
Stock #R2096 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location189640606-189688086 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 189653459 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 2208 (V2208A)
Ref Sequence ENSEMBL: ENSMUSP00000129738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171929]
Predicted Effect probably benign
Transcript: ENSMUST00000165798
SMART Domains Protein: ENSMUSP00000132430
Gene: ENSMUSG00000026605

DomainStartEndE-ValueType
Pfam:CENP-F_C_Rb_bdg 23 50 1.6e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171929
AA Change: V2208A

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129738
Gene: ENSMUSG00000026605
AA Change: V2208A

DomainStartEndE-ValueType
Pfam:CENP-F_N 1 300 2.8e-144 PFAM
low complexity region 349 364 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 589 609 N/A INTRINSIC
internal_repeat_5 678 707 8.32e-5 PROSPERO
internal_repeat_3 743 798 2.21e-5 PROSPERO
internal_repeat_1 780 812 2.12e-7 PROSPERO
coiled coil region 829 881 N/A INTRINSIC
coiled coil region 902 1169 N/A INTRINSIC
coiled coil region 1206 1364 N/A INTRINSIC
internal_repeat_2 1381 1413 3.02e-6 PROSPERO
internal_repeat_3 1412 1470 2.21e-5 PROSPERO
low complexity region 1526 1542 N/A INTRINSIC
coiled coil region 1560 1650 N/A INTRINSIC
internal_repeat_2 1655 1687 3.02e-6 PROSPERO
low complexity region 1744 1755 N/A INTRINSIC
coiled coil region 1822 1852 N/A INTRINSIC
Pfam:CENP-F_leu_zip 1893 2035 1.2e-14 PFAM
Pfam:CENP-F_leu_zip 2131 2270 1.5e-47 PFAM
Pfam:CENP-F_leu_zip 2313 2449 1e-46 PFAM
low complexity region 2544 2555 N/A INTRINSIC
low complexity region 2642 2654 N/A INTRINSIC
low complexity region 2755 2769 N/A INTRINSIC
internal_repeat_4 2778 2801 4.28e-5 PROSPERO
low complexity region 2837 2847 N/A INTRINSIC
Pfam:CENP-F_C_Rb_bdg 2850 2896 6.6e-29 PFAM
internal_repeat_1 2935 2964 2.12e-7 PROSPERO
internal_repeat_4 2946 2969 4.28e-5 PROSPERO
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that associates with the centromere-kinetochore complex. The protein is a component of the nuclear matrix during the G2 phase of interphase. In late G2 the protein associates with the kinetochore and maintains this association through early anaphase. It localizes to the spindle midzone and the intracellular bridge in late anaphase and telophase, respectively, and is thought to be subsequently degraded. The localization of this protein suggests that it may play a role in chromosome segregation during mitotis. It is thought to form either a homodimer or heterodimer. Autoantibodies against this protein have been found in patients with cancer or graft versus host disease. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 A G 8: 123,982,456 S120P probably benign Het
Actr3b T A 5: 25,831,745 Y185* probably null Het
Atg101 T A 15: 101,290,501 H162Q possibly damaging Het
BC005561 T C 5: 104,519,969 S786P possibly damaging Het
Btf3 T A 13: 98,313,151 Q109L possibly damaging Het
Camk2d G A 3: 126,780,442 G166D probably damaging Het
Capn7 T G 14: 31,349,887 probably null Het
Cd209f A G 8: 4,105,537 V17A probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Comp T C 8: 70,376,063 C182R probably damaging Het
Ctsl A G 13: 64,369,026 probably null Het
Cyp3a44 G T 5: 145,788,405 Q329K probably damaging Het
Dcpp1 A T 17: 23,880,997 probably null Het
Dhx38 A G 8: 109,554,259 V831A probably damaging Het
Dkk2 T C 3: 132,086,097 M22T probably benign Het
Dnah2 C T 11: 69,455,916 E2615K probably damaging Het
Dpy19l3 A G 7: 35,727,288 probably null Het
Fam196b C A 11: 34,402,936 S326Y probably benign Het
Gm12888 T G 4: 121,319,458 I49L probably benign Het
Kif15 T A 9: 122,986,187 M194K probably damaging Het
Mael G T 1: 166,225,675 Q254K probably benign Het
Nek9 T C 12: 85,314,548 D461G probably benign Het
Nlrp12 T C 7: 3,233,195 N819S probably benign Het
Ntng1 T A 3: 109,832,555 N390Y probably damaging Het
Olfr1002 A G 2: 85,648,090 I77T probably benign Het
P2ry14 C T 3: 59,115,317 V250I probably damaging Het
Pcnx2 A T 8: 125,759,248 D1870E probably benign Het
Phf2 T A 13: 48,832,113 K64* probably null Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Ppa2 A G 3: 133,326,684 T97A probably damaging Het
Psd G A 19: 46,324,649 probably null Het
Psg23 T A 7: 18,614,743 E46D probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rab11b A G 17: 33,749,002 Y74H probably damaging Het
Rfc3 A T 5: 151,644,918 S194R probably benign Het
Sema4d A T 13: 51,710,001 I414N probably damaging Het
Serpinb1a A T 13: 32,847,454 D120E probably damaging Het
Snai2 T A 16: 14,706,997 H122Q possibly damaging Het
Spats2l T C 1: 57,946,299 S504P probably benign Het
Sprr2j-ps T C 3: 92,419,105 S96P unknown Het
Sspo G T 6: 48,461,674 V1559L probably benign Het
Tas2r118 T G 6: 23,969,913 I50L possibly damaging Het
Tdrd3 C T 14: 87,506,352 Q573* probably null Het
Tlnrd1 G A 7: 83,882,854 T123I probably benign Het
Tmem214 T A 5: 30,876,370 L555H probably damaging Het
Tmprss12 T A 15: 100,285,236 M153K probably benign Het
Tmprss9 G A 10: 80,889,434 G410S probably damaging Het
Trpm6 T A 19: 18,825,752 M853K probably damaging Het
Vmn1r35 A G 6: 66,678,945 I247T possibly damaging Het
Zcchc7 C A 4: 44,931,059 P404T probably damaging Het
Zzef1 T C 11: 72,872,639 F1371L probably benign Het
Other mutations in Cenpf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Cenpf APN 1 189654912 missense probably benign 0.01
IGL01154:Cenpf APN 1 189680333 missense probably benign 0.19
IGL01434:Cenpf APN 1 189657868 nonsense probably null
IGL01461:Cenpf APN 1 189657096 missense probably damaging 1.00
IGL01615:Cenpf APN 1 189653184 missense possibly damaging 0.68
IGL01720:Cenpf APN 1 189682386 missense probably benign 0.05
IGL01720:Cenpf APN 1 189651215 missense probably damaging 0.99
IGL01803:Cenpf APN 1 189654771 nonsense probably null
IGL02152:Cenpf APN 1 189649012 missense probably benign
IGL02222:Cenpf APN 1 189654444 missense probably benign
IGL02338:Cenpf APN 1 189680418 missense probably damaging 1.00
IGL02580:Cenpf APN 1 189657441 missense probably benign 0.20
IGL02629:Cenpf APN 1 189652334 missense probably damaging 1.00
IGL02650:Cenpf APN 1 189652473 missense possibly damaging 0.91
IGL02660:Cenpf APN 1 189654782 missense probably damaging 1.00
IGL02703:Cenpf APN 1 189659758 missense probably benign 0.14
IGL02809:Cenpf APN 1 189682358 splice site probably benign
IGL02851:Cenpf APN 1 189658030 missense probably damaging 1.00
IGL02903:Cenpf APN 1 189646876 missense probably damaging 0.99
IGL03126:Cenpf APN 1 189659010 missense probably damaging 1.00
IGL03235:Cenpf APN 1 189683927 missense probably damaging 1.00
IGL03336:Cenpf APN 1 189652647 missense probably damaging 0.99
IGL03402:Cenpf APN 1 189655076 missense probably damaging 1.00
IGL02799:Cenpf UTSW 1 189659652 missense probably damaging 1.00
R0011:Cenpf UTSW 1 189650706 missense probably benign 0.05
R0129:Cenpf UTSW 1 189659650 missense probably benign 0.26
R0157:Cenpf UTSW 1 189652359 missense probably benign 0.07
R0270:Cenpf UTSW 1 189650714 missense probably benign 0.01
R0607:Cenpf UTSW 1 189682463 splice site probably null
R0621:Cenpf UTSW 1 189672628 missense probably benign
R0639:Cenpf UTSW 1 189658062 missense probably benign 0.01
R0653:Cenpf UTSW 1 189659986 missense probably damaging 1.00
R0718:Cenpf UTSW 1 189653984 missense probably damaging 1.00
R1157:Cenpf UTSW 1 189658453 missense probably benign 0.20
R1331:Cenpf UTSW 1 189642801 missense probably damaging 0.99
R1463:Cenpf UTSW 1 189654739 missense probably damaging 0.97
R1514:Cenpf UTSW 1 189679141 missense possibly damaging 0.67
R1529:Cenpf UTSW 1 189660038 missense probably benign 0.00
R1574:Cenpf UTSW 1 189652713 missense probably damaging 1.00
R1574:Cenpf UTSW 1 189652713 missense probably damaging 1.00
R1662:Cenpf UTSW 1 189657771 missense probably damaging 0.99
R1671:Cenpf UTSW 1 189679144 splice site probably null
R1725:Cenpf UTSW 1 189680479 missense probably damaging 0.99
R1743:Cenpf UTSW 1 189654263 missense probably benign 0.19
R1874:Cenpf UTSW 1 189683816 missense probably damaging 1.00
R1884:Cenpf UTSW 1 189646849 missense probably benign
R1980:Cenpf UTSW 1 189653915 missense probably benign 0.04
R2074:Cenpf UTSW 1 189656901 missense probably damaging 1.00
R2109:Cenpf UTSW 1 189679067 missense probably damaging 0.99
R2113:Cenpf UTSW 1 189679102 missense probably damaging 0.96
R2134:Cenpf UTSW 1 189658642 missense probably benign 0.03
R2209:Cenpf UTSW 1 189652598 missense probably benign 0.04
R2875:Cenpf UTSW 1 189658644 missense probably benign 0.11
R2876:Cenpf UTSW 1 189658644 missense probably benign 0.11
R3433:Cenpf UTSW 1 189659949 missense probably damaging 0.99
R3709:Cenpf UTSW 1 189648812 missense possibly damaging 0.72
R3786:Cenpf UTSW 1 189658337 missense probably damaging 1.00
R4014:Cenpf UTSW 1 189653159 missense probably benign 0.01
R4108:Cenpf UTSW 1 189683868 missense probably damaging 1.00
R4119:Cenpf UTSW 1 189653045 missense probably benign 0.01
R4177:Cenpf UTSW 1 189668619 missense possibly damaging 0.95
R4422:Cenpf UTSW 1 189658350 missense probably damaging 1.00
R4546:Cenpf UTSW 1 189654650 missense probably damaging 1.00
R4592:Cenpf UTSW 1 189679033 missense probably damaging 1.00
R4643:Cenpf UTSW 1 189659589 missense probably benign 0.00
R4650:Cenpf UTSW 1 189660038 missense probably benign 0.00
R4801:Cenpf UTSW 1 189651220 missense probably damaging 1.00
R4802:Cenpf UTSW 1 189651220 missense probably damaging 1.00
R4817:Cenpf UTSW 1 189682369 missense possibly damaging 0.93
R4871:Cenpf UTSW 1 189658531 missense probably damaging 1.00
R5037:Cenpf UTSW 1 189683846 missense probably damaging 1.00
R5106:Cenpf UTSW 1 189683808 missense probably benign 0.00
R5208:Cenpf UTSW 1 189671046 critical splice donor site probably null
R5213:Cenpf UTSW 1 189654980 missense probably benign 0.04
R5237:Cenpf UTSW 1 189659533 missense probably benign 0.28
R5255:Cenpf UTSW 1 189672627 missense possibly damaging 0.49
R5378:Cenpf UTSW 1 189653466 missense possibly damaging 0.95
R5468:Cenpf UTSW 1 189652371 missense probably damaging 1.00
R5510:Cenpf UTSW 1 189682903 missense probably benign 0.14
R5616:Cenpf UTSW 1 189657286 missense probably damaging 1.00
R5652:Cenpf UTSW 1 189657082 missense probably damaging 0.99
R5735:Cenpf UTSW 1 189654363 missense probably benign 0.10
R5841:Cenpf UTSW 1 189657444 missense possibly damaging 0.90
R5943:Cenpf UTSW 1 189659969 missense possibly damaging 0.75
R6082:Cenpf UTSW 1 189658104 missense probably benign 0.11
R6108:Cenpf UTSW 1 189662013 missense probably benign 0.03
R6269:Cenpf UTSW 1 189659920 missense probably benign 0.37
R6284:Cenpf UTSW 1 189652742 missense probably damaging 1.00
R6425:Cenpf UTSW 1 189659898 missense probably benign 0.09
R6587:Cenpf UTSW 1 189658374 missense probably damaging 1.00
R6747:Cenpf UTSW 1 189652854 missense probably benign 0.15
R6811:Cenpf UTSW 1 189654542 missense probably benign 0.06
R6834:Cenpf UTSW 1 189659446 missense probably damaging 1.00
R6951:Cenpf UTSW 1 189653792 missense probably damaging 1.00
R7095:Cenpf UTSW 1 189659176 missense probably benign 0.01
R7128:Cenpf UTSW 1 189684991 missense probably damaging 1.00
R7185:Cenpf UTSW 1 189653489 missense probably damaging 1.00
R7292:Cenpf UTSW 1 189650694 missense probably damaging 1.00
R7353:Cenpf UTSW 1 189654138 nonsense probably null
R7402:Cenpf UTSW 1 189659378 nonsense probably null
R7460:Cenpf UTSW 1 189654050 missense probably damaging 0.97
R7484:Cenpf UTSW 1 189656821 missense probably damaging 1.00
R7574:Cenpf UTSW 1 189658667 missense probably damaging 1.00
R7691:Cenpf UTSW 1 189658207 nonsense probably null
R7698:Cenpf UTSW 1 189662072 missense probably benign 0.01
R7901:Cenpf UTSW 1 189657248 missense probably damaging 1.00
R7984:Cenpf UTSW 1 189657248 missense probably damaging 1.00
RF006:Cenpf UTSW 1 189657386 missense probably damaging 1.00
X0025:Cenpf UTSW 1 189653874 missense possibly damaging 0.79
X0066:Cenpf UTSW 1 189657929 missense probably benign 0.23
Z1088:Cenpf UTSW 1 189652931 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCATTACACAAGGCTGC -3'
(R):5'- AGCGTGAAAGCGACTCATTG -3'

Sequencing Primer
(F):5'- GTCATTACACAAGGCTGCCACTTC -3'
(R):5'- CTCATTGAAGGATACAGTGGAGACTC -3'
Posted On2014-09-18