Incidental Mutation 'R2096:Tmem214'
ID232096
Institutional Source Beutler Lab
Gene Symbol Tmem214
Ensembl Gene ENSMUSG00000038828
Gene Nametransmembrane protein 214
Synonyms
MMRRC Submission 040100-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.626) question?
Stock #R2096 (G1)
Quality Score137
Status Not validated
Chromosome5
Chromosomal Location30868012-30879180 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30876370 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 555 (L555H)
Ref Sequence ENSEMBL: ENSMUSP00000110364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114716] [ENSMUST00000201203]
Predicted Effect probably damaging
Transcript: ENSMUST00000046349
AA Change: L600H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037484
Gene: ENSMUSG00000038828
AA Change: L600H

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
low complexity region 84 94 N/A INTRINSIC
Pfam:DUF2359 217 683 6.9e-246 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114716
AA Change: L555H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000110364
Gene: ENSMUSG00000038828
AA Change: L555H

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
low complexity region 84 94 N/A INTRINSIC
Pfam:DUF2359 172 638 8e-247 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201203
AA Change: L600H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144615
Gene: ENSMUSG00000038828
AA Change: L600H

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
low complexity region 84 94 N/A INTRINSIC
Pfam:DUF2359 217 683 6.9e-246 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201234
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202774
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202951
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 A G 8: 123,982,456 S120P probably benign Het
Actr3b T A 5: 25,831,745 Y185* probably null Het
Atg101 T A 15: 101,290,501 H162Q possibly damaging Het
BC005561 T C 5: 104,519,969 S786P possibly damaging Het
Btf3 T A 13: 98,313,151 Q109L possibly damaging Het
Camk2d G A 3: 126,780,442 G166D probably damaging Het
Capn7 T G 14: 31,349,887 probably null Het
Cd209f A G 8: 4,105,537 V17A probably benign Het
Cenpf A G 1: 189,653,459 V2208A possibly damaging Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Comp T C 8: 70,376,063 C182R probably damaging Het
Ctsl A G 13: 64,369,026 probably null Het
Cyp3a44 G T 5: 145,788,405 Q329K probably damaging Het
Dcpp1 A T 17: 23,880,997 probably null Het
Dhx38 A G 8: 109,554,259 V831A probably damaging Het
Dkk2 T C 3: 132,086,097 M22T probably benign Het
Dnah2 C T 11: 69,455,916 E2615K probably damaging Het
Dpy19l3 A G 7: 35,727,288 probably null Het
Fam196b C A 11: 34,402,936 S326Y probably benign Het
Gm12888 T G 4: 121,319,458 I49L probably benign Het
Kif15 T A 9: 122,986,187 M194K probably damaging Het
Mael G T 1: 166,225,675 Q254K probably benign Het
Nek9 T C 12: 85,314,548 D461G probably benign Het
Nlrp12 T C 7: 3,233,195 N819S probably benign Het
Ntng1 T A 3: 109,832,555 N390Y probably damaging Het
Olfr1002 A G 2: 85,648,090 I77T probably benign Het
P2ry14 C T 3: 59,115,317 V250I probably damaging Het
Pcnx2 A T 8: 125,759,248 D1870E probably benign Het
Phf2 T A 13: 48,832,113 K64* probably null Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Ppa2 A G 3: 133,326,684 T97A probably damaging Het
Psd G A 19: 46,324,649 probably null Het
Psg23 T A 7: 18,614,743 E46D probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rab11b A G 17: 33,749,002 Y74H probably damaging Het
Rfc3 A T 5: 151,644,918 S194R probably benign Het
Sema4d A T 13: 51,710,001 I414N probably damaging Het
Serpinb1a A T 13: 32,847,454 D120E probably damaging Het
Snai2 T A 16: 14,706,997 H122Q possibly damaging Het
Spats2l T C 1: 57,946,299 S504P probably benign Het
Sprr2j-ps T C 3: 92,419,105 S96P unknown Het
Sspo G T 6: 48,461,674 V1559L probably benign Het
Tas2r118 T G 6: 23,969,913 I50L possibly damaging Het
Tdrd3 C T 14: 87,506,352 Q573* probably null Het
Tlnrd1 G A 7: 83,882,854 T123I probably benign Het
Tmprss12 T A 15: 100,285,236 M153K probably benign Het
Tmprss9 G A 10: 80,889,434 G410S probably damaging Het
Trpm6 T A 19: 18,825,752 M853K probably damaging Het
Vmn1r35 A G 6: 66,678,945 I247T possibly damaging Het
Zcchc7 C A 4: 44,931,059 P404T probably damaging Het
Zzef1 T C 11: 72,872,639 F1371L probably benign Het
Other mutations in Tmem214
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:Tmem214 APN 5 30876093 missense probably benign 0.15
IGL02119:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02123:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02124:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02126:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02186:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02395:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02396:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02397:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02400:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02403:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02404:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02539:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02544:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02934:Tmem214 APN 5 30871544 missense probably benign 0.26
PIT4382001:Tmem214 UTSW 5 30871451 missense possibly damaging 0.89
R0501:Tmem214 UTSW 5 30872532 missense probably damaging 1.00
R0519:Tmem214 UTSW 5 30869668 start codon destroyed probably null 0.98
R0675:Tmem214 UTSW 5 30871825 missense possibly damaging 0.70
R1204:Tmem214 UTSW 5 30875790 missense probably damaging 0.97
R1616:Tmem214 UTSW 5 30871563 nonsense probably null
R2219:Tmem214 UTSW 5 30873631 missense possibly damaging 0.72
R5635:Tmem214 UTSW 5 30871517 missense probably damaging 1.00
R6003:Tmem214 UTSW 5 30870724 missense possibly damaging 0.52
R6744:Tmem214 UTSW 5 30874028 missense probably damaging 1.00
R7208:Tmem214 UTSW 5 30870721 missense possibly damaging 0.52
R8155:Tmem214 UTSW 5 30871792 missense possibly damaging 0.56
R8335:Tmem214 UTSW 5 30872122 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CTGCTTCAGTGATAGCCTGG -3'
(R):5'- CCCTCTTTCCAGAGTGATTGTG -3'

Sequencing Primer
(F):5'- CCTGGCTGGCTTCTTTCAGAG -3'
(R):5'- AATGGATGCTATACCTTGTTCCCAGG -3'
Posted On2014-09-18