Incidental Mutation 'R0193:9330182L06Rik'
ID23210
Institutional Source Beutler Lab
Gene Symbol 9330182L06Rik
Ensembl Gene ENSMUSG00000056004
Gene NameRIKEN cDNA 9330182L06 gene
Synonyms
MMRRC Submission 038452-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0193 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location9266118-9481825 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 9422359 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 352 (Q352L)
Ref Sequence ENSEMBL: ENSMUSP00000120849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069538] [ENSMUST00000115348] [ENSMUST00000134991] [ENSMUST00000152095] [ENSMUST00000154662] [ENSMUST00000155764]
Predicted Effect probably benign
Transcript: ENSMUST00000069538
AA Change: Q352L

PolyPhen 2 Score 0.253 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000069165
Gene: ENSMUSG00000056004
AA Change: Q352L

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
internal_repeat_1 58 334 1.12e-7 PROSPERO
internal_repeat_1 343 665 1.12e-7 PROSPERO
transmembrane domain 926 948 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115348
SMART Domains Protein: ENSMUSP00000111005
Gene: ENSMUSG00000056004

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
low complexity region 213 224 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134991
AA Change: Q352L

PolyPhen 2 Score 0.253 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000121757
Gene: ENSMUSG00000056004
AA Change: Q352L

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
internal_repeat_1 58 334 9.82e-8 PROSPERO
internal_repeat_1 343 665 9.82e-8 PROSPERO
transmembrane domain 926 948 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142202
Predicted Effect probably benign
Transcript: ENSMUST00000152095
SMART Domains Protein: ENSMUSP00000116440
Gene: ENSMUSG00000056004

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154662
SMART Domains Protein: ENSMUSP00000116026
Gene: ENSMUSG00000056004

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000155764
AA Change: Q352L

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120849
Gene: ENSMUSG00000056004
AA Change: Q352L

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
internal_repeat_1 58 180 5.47e-6 PROSPERO
internal_repeat_1 343 476 5.47e-6 PROSPERO
Meta Mutation Damage Score 0.1514 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 94.7%
  • 20x: 85.3%
Validation Efficiency 95% (186/196)
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 T C 15: 74,572,156 S96P probably damaging Het
Akr1c20 A G 13: 4,511,293 probably benign Het
Atp2a3 G T 11: 72,972,220 V99L possibly damaging Het
Atp6v0a1 T A 11: 101,048,482 I691N possibly damaging Het
Atp8b1 C T 18: 64,561,636 R525Q probably benign Het
Aurkb A G 11: 69,048,544 D151G probably damaging Het
Bank1 A T 3: 136,066,518 probably benign Het
Bcl9l T C 9: 44,507,406 L847P probably damaging Het
Bscl2 T A 19: 8,847,429 M292K probably benign Het
Cacna1c C T 6: 118,602,402 probably benign Het
Cadps2 T C 6: 23,599,440 K260R probably benign Het
Cc2d2a T C 5: 43,736,118 S1419P probably damaging Het
Ccdc180 G A 4: 45,914,803 E145K probably benign Het
Ccdc58 T C 16: 36,082,814 S59P probably damaging Het
Ccno C T 13: 112,988,884 probably benign Het
Cd300a A G 11: 114,893,376 D70G probably benign Het
Cenpc1 T C 5: 86,032,403 D670G probably benign Het
Cenpl A G 1: 161,085,988 I323V probably damaging Het
Cfap44 A G 16: 44,449,210 probably null Het
Cfap74 C T 4: 155,426,115 R386C probably benign Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Clcnkb T C 4: 141,412,316 E125G possibly damaging Het
Clstn1 G A 4: 149,634,796 V361M probably damaging Het
Coro7 G A 16: 4,627,504 probably benign Het
Dchs1 C T 7: 105,764,983 R875H probably benign Het
Eif3j1 A C 2: 122,052,027 M239L probably benign Het
Eif4g3 G T 4: 138,146,376 probably benign Het
Erbb4 T C 1: 68,043,960 probably benign Het
Erlin2 T G 8: 27,031,764 V164G possibly damaging Het
Fbxo43 G T 15: 36,161,883 Q393K probably benign Het
Fcgr4 A T 1: 171,025,760 N178I possibly damaging Het
Grid2 A G 6: 64,063,953 N293S possibly damaging Het
H2-M1 C T 17: 36,671,332 V126I probably benign Het
Htr1f T A 16: 64,926,749 Y60F probably damaging Het
Ilf2 A G 3: 90,481,339 probably null Het
Impg2 A T 16: 56,265,049 K931* probably null Het
Ints1 T C 5: 139,751,730 E2176G probably damaging Het
Iqsec2 T C X: 152,223,403 V1319A probably benign Het
Iqsec3 G T 6: 121,410,724 D685E probably damaging Het
Itgbl1 G A 14: 123,846,546 V279I probably benign Het
Kdm4b C T 17: 56,393,952 A541V probably benign Het
Kif14 A T 1: 136,468,438 T161S probably benign Het
Krt86 T C 15: 101,479,363 probably benign Het
Kyat1 C T 2: 30,187,186 probably null Het
Limch1 T C 5: 67,027,539 W791R probably damaging Het
Map3k11 T A 19: 5,695,846 M396K probably damaging Het
Mat2a A G 6: 72,436,195 probably null Het
Mbnl2 A G 14: 120,379,237 I88V possibly damaging Het
Mib2 T C 4: 155,655,673 T708A probably benign Het
Mkks T C 2: 136,877,606 probably null Het
Mtss1 T C 15: 58,944,017 M565V probably damaging Het
Myoc A G 1: 162,649,035 N436S probably damaging Het
Myod1 T A 7: 46,377,112 V147E probably damaging Het
Ngef A G 1: 87,509,334 L144P probably benign Het
Ngrn C T 7: 80,261,930 R92W probably damaging Het
Nup153 G A 13: 46,709,654 T349I probably benign Het
Olfr1211 T A 2: 88,930,283 I11L probably benign Het
Olfr600 G T 7: 103,346,204 S241R possibly damaging Het
Pigl A G 11: 62,503,748 I135M probably damaging Het
Pitpnm3 A G 11: 72,070,492 probably benign Het
Pkhd1 A T 1: 20,358,917 F2420I probably damaging Het
Polr2b C T 5: 77,320,076 T119M probably damaging Het
Prr29 A G 11: 106,376,896 Y130C probably damaging Het
Rab11fip3 T C 17: 25,990,999 I1048V probably damaging Het
Rab12 G A 17: 66,500,362 T124I probably damaging Het
Rab44 A G 17: 29,140,307 S490G probably benign Het
Rasa3 A G 8: 13,570,233 probably null Het
Rhbdl3 C T 11: 80,353,574 S369L possibly damaging Het
Rimbp2 A T 5: 128,788,356 S643T probably benign Het
Rin1 T G 19: 5,052,652 S396R probably damaging Het
Rpusd3 C T 6: 113,419,237 G28S probably damaging Het
Rtl9 T A X: 143,100,278 S229T probably damaging Het
Rufy1 G T 11: 50,389,852 T701N probably benign Het
Scn4a A T 11: 106,320,538 L1551* probably null Het
Sec24b T C 3: 129,988,984 N1119S probably null Het
Serbp1 T A 6: 67,272,884 *75R probably null Het
Setx C T 2: 29,179,673 P2497S probably benign Het
Slc26a11 A T 11: 119,359,314 I132F probably damaging Het
Slc4a1 A G 11: 102,352,684 V707A possibly damaging Het
Slfn1 A G 11: 83,121,843 I262V probably damaging Het
Tmem168 T A 6: 13,583,313 D523V possibly damaging Het
Traf7 G T 17: 24,510,551 Q469K probably benign Het
Trdmt1 C A 2: 13,544,617 V6F probably damaging Het
Tsacc A T 3: 88,287,088 probably benign Het
Vmn2r5 A G 3: 64,491,530 I589T possibly damaging Het
Vmn2r7 T C 3: 64,691,039 D699G probably damaging Het
Vmn2r82 T C 10: 79,381,295 V487A probably damaging Het
Zfp287 A T 11: 62,715,029 S351T probably benign Het
Zfp651 T C 9: 121,767,666 V696A probably damaging Het
Zfp654 T C 16: 64,785,688 H176R possibly damaging Het
Other mutations in 9330182L06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:9330182L06Rik APN 5 9422367 missense probably damaging 0.99
IGL00909:9330182L06Rik APN 5 9380282 missense probably damaging 1.00
IGL01477:9330182L06Rik APN 5 9437756 missense probably damaging 1.00
IGL02486:9330182L06Rik APN 5 9422323 missense probably benign 0.00
IGL02863:9330182L06Rik APN 5 9461399 nonsense probably null
IGL02939:9330182L06Rik APN 5 9461478 missense probably damaging 1.00
IGL03039:9330182L06Rik APN 5 9418055 missense probably benign 0.12
IGL03395:9330182L06Rik APN 5 9422359 missense probably damaging 0.97
R0063:9330182L06Rik UTSW 5 9440709 intron probably benign
R0063:9330182L06Rik UTSW 5 9440709 intron probably benign
R0265:9330182L06Rik UTSW 5 9434681 missense probably damaging 1.00
R0398:9330182L06Rik UTSW 5 9445367 missense probably benign 0.00
R0432:9330182L06Rik UTSW 5 9440966 nonsense probably null
R0494:9330182L06Rik UTSW 5 9420723 critical splice donor site probably null
R0736:9330182L06Rik UTSW 5 9441745 missense probably damaging 1.00
R0850:9330182L06Rik UTSW 5 9417993 missense probably damaging 1.00
R1398:9330182L06Rik UTSW 5 9380297 missense probably damaging 1.00
R1709:9330182L06Rik UTSW 5 9440726 nonsense probably null
R1720:9330182L06Rik UTSW 5 9428407 missense probably damaging 1.00
R1770:9330182L06Rik UTSW 5 9418021 missense probably benign 0.01
R1782:9330182L06Rik UTSW 5 9421620 missense possibly damaging 0.62
R1803:9330182L06Rik UTSW 5 9427832 missense probably benign 0.05
R1868:9330182L06Rik UTSW 5 9479251 missense probably damaging 1.00
R1870:9330182L06Rik UTSW 5 9418007 missense probably damaging 0.97
R1871:9330182L06Rik UTSW 5 9418007 missense probably damaging 0.97
R1913:9330182L06Rik UTSW 5 9266275 missense probably damaging 0.97
R2054:9330182L06Rik UTSW 5 9463030 missense possibly damaging 0.81
R2170:9330182L06Rik UTSW 5 9479206 missense probably damaging 1.00
R2381:9330182L06Rik UTSW 5 9380342 missense probably damaging 1.00
R2396:9330182L06Rik UTSW 5 9435395 missense possibly damaging 0.92
R4003:9330182L06Rik UTSW 5 9440877 missense probably benign 0.05
R5030:9330182L06Rik UTSW 5 9428502 missense probably damaging 1.00
R5049:9330182L06Rik UTSW 5 9428488 missense probably damaging 1.00
R5069:9330182L06Rik UTSW 5 9440897 missense probably damaging 1.00
R5219:9330182L06Rik UTSW 5 9461486 missense probably damaging 1.00
R5400:9330182L06Rik UTSW 5 9479247 missense probably damaging 1.00
R5555:9330182L06Rik UTSW 5 9422296 splice site probably null
R5593:9330182L06Rik UTSW 5 9266350 missense probably benign 0.07
R5681:9330182L06Rik UTSW 5 9459308 critical splice donor site probably null
R5707:9330182L06Rik UTSW 5 9441698 missense probably damaging 1.00
R5756:9330182L06Rik UTSW 5 9462995 missense probably damaging 0.98
R6087:9330182L06Rik UTSW 5 9399255 missense probably damaging 1.00
R6252:9330182L06Rik UTSW 5 9410693 missense probably damaging 1.00
R7067:9330182L06Rik UTSW 5 9266295 missense possibly damaging 0.81
R7078:9330182L06Rik UTSW 5 9410709 missense probably benign 0.10
R7079:9330182L06Rik UTSW 5 9399253 missense probably damaging 1.00
R7117:9330182L06Rik UTSW 5 9445384 nonsense probably null
R7265:9330182L06Rik UTSW 5 9446975 missense possibly damaging 0.65
R7996:9330182L06Rik UTSW 5 9462881 missense probably damaging 1.00
R8199:9330182L06Rik UTSW 5 9420657 missense probably damaging 1.00
R8246:9330182L06Rik UTSW 5 9446966 missense probably benign 0.07
R8935:9330182L06Rik UTSW 5 9441764 missense probably damaging 1.00
R8963:9330182L06Rik UTSW 5 9437792 missense probably damaging 1.00
X0019:9330182L06Rik UTSW 5 9399231 missense probably damaging 0.97
X0052:9330182L06Rik UTSW 5 9440908 missense possibly damaging 0.87
X0063:9330182L06Rik UTSW 5 9399239 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTCGTCTGGAAAACAGTCACCAC -3'
(R):5'- AAGGGCAGTTTGCAGCACCTAC -3'

Sequencing Primer
(F):5'- GTTATCCTCCTTTCAGAGAGACTG -3'
(R):5'- GCAGCACCTACACTCTTGG -3'
Posted On2013-04-16