Incidental Mutation 'R0193:Limch1'
ID23211
Institutional Source Beutler Lab
Gene Symbol Limch1
Ensembl Gene ENSMUSG00000037736
Gene NameLIM and calponin homology domains 1
Synonyms3732412D22Rik
MMRRC Submission 038452-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R0193 (G1)
Quality Score202
Status Validated (trace)
Chromosome5
Chromosomal Location66745827-67057158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67027539 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 791 (W791R)
Ref Sequence ENSEMBL: ENSMUSP00000112732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038188] [ENSMUST00000101164] [ENSMUST00000117601] [ENSMUST00000118242]
Predicted Effect probably damaging
Transcript: ENSMUST00000038188
AA Change: W624R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043163
Gene: ENSMUSG00000037736
AA Change: W624R

DomainStartEndE-ValueType
low complexity region 41 57 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
low complexity region 129 140 N/A INTRINSIC
coiled coil region 192 241 N/A INTRINSIC
low complexity region 411 430 N/A INTRINSIC
coiled coil region 615 672 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
LIM 830 888 5.08e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000101164
AA Change: W780R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098723
Gene: ENSMUSG00000037736
AA Change: W780R

DomainStartEndE-ValueType
CH 23 124 2.09e-13 SMART
low complexity region 197 213 N/A INTRINSIC
low complexity region 223 236 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
coiled coil region 348 397 N/A INTRINSIC
low complexity region 567 586 N/A INTRINSIC
coiled coil region 771 828 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
LIM 986 1044 5.08e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117601
AA Change: W621R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113544
Gene: ENSMUSG00000037736
AA Change: W621R

DomainStartEndE-ValueType
CH 23 124 1e-15 SMART
low complexity region 197 213 N/A INTRINSIC
low complexity region 223 236 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
coiled coil region 348 397 N/A INTRINSIC
low complexity region 567 586 N/A INTRINSIC
coiled coil region 704 752 N/A INTRINSIC
low complexity region 759 771 N/A INTRINSIC
LIM 910 968 2.4e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118242
AA Change: W791R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112732
Gene: ENSMUSG00000037736
AA Change: W791R

DomainStartEndE-ValueType
CH 23 124 2.09e-13 SMART
low complexity region 197 213 N/A INTRINSIC
low complexity region 223 236 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
coiled coil region 336 385 N/A INTRINSIC
low complexity region 555 574 N/A INTRINSIC
coiled coil region 782 839 N/A INTRINSIC
low complexity region 846 858 N/A INTRINSIC
LIM 997 1055 5.08e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000119854
AA Change: W496R
SMART Domains Protein: ENSMUSP00000112651
Gene: ENSMUSG00000037736
AA Change: W496R

DomainStartEndE-ValueType
CH 23 124 2.09e-13 SMART
low complexity region 197 213 N/A INTRINSIC
low complexity region 223 236 N/A INTRINSIC
Pfam:DUF4757 250 418 5.2e-66 PFAM
low complexity region 567 586 N/A INTRINSIC
coiled coil region 771 828 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
low complexity region 989 1003 N/A INTRINSIC
LIM 1012 1070 5.08e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140428
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201322
Meta Mutation Damage Score 0.2938 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 94.7%
  • 20x: 85.3%
Validation Efficiency 95% (186/196)
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,422,359 Q352L probably damaging Het
Adgrb1 T C 15: 74,572,156 S96P probably damaging Het
Akr1c20 A G 13: 4,511,293 probably benign Het
Atp2a3 G T 11: 72,972,220 V99L possibly damaging Het
Atp6v0a1 T A 11: 101,048,482 I691N possibly damaging Het
Atp8b1 C T 18: 64,561,636 R525Q probably benign Het
Aurkb A G 11: 69,048,544 D151G probably damaging Het
Bank1 A T 3: 136,066,518 probably benign Het
Bcl9l T C 9: 44,507,406 L847P probably damaging Het
Bscl2 T A 19: 8,847,429 M292K probably benign Het
Cacna1c C T 6: 118,602,402 probably benign Het
Cadps2 T C 6: 23,599,440 K260R probably benign Het
Cc2d2a T C 5: 43,736,118 S1419P probably damaging Het
Ccdc180 G A 4: 45,914,803 E145K probably benign Het
Ccdc58 T C 16: 36,082,814 S59P probably damaging Het
Ccno C T 13: 112,988,884 probably benign Het
Cd300a A G 11: 114,893,376 D70G probably benign Het
Cenpc1 T C 5: 86,032,403 D670G probably benign Het
Cenpl A G 1: 161,085,988 I323V probably damaging Het
Cfap44 A G 16: 44,449,210 probably null Het
Cfap74 C T 4: 155,426,115 R386C probably benign Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Clcnkb T C 4: 141,412,316 E125G possibly damaging Het
Clstn1 G A 4: 149,634,796 V361M probably damaging Het
Coro7 G A 16: 4,627,504 probably benign Het
Dchs1 C T 7: 105,764,983 R875H probably benign Het
Eif3j1 A C 2: 122,052,027 M239L probably benign Het
Eif4g3 G T 4: 138,146,376 probably benign Het
Erbb4 T C 1: 68,043,960 probably benign Het
Erlin2 T G 8: 27,031,764 V164G possibly damaging Het
Fbxo43 G T 15: 36,161,883 Q393K probably benign Het
Fcgr4 A T 1: 171,025,760 N178I possibly damaging Het
Grid2 A G 6: 64,063,953 N293S possibly damaging Het
H2-M1 C T 17: 36,671,332 V126I probably benign Het
Htr1f T A 16: 64,926,749 Y60F probably damaging Het
Ilf2 A G 3: 90,481,339 probably null Het
Impg2 A T 16: 56,265,049 K931* probably null Het
Ints1 T C 5: 139,751,730 E2176G probably damaging Het
Iqsec2 T C X: 152,223,403 V1319A probably benign Het
Iqsec3 G T 6: 121,410,724 D685E probably damaging Het
Itgbl1 G A 14: 123,846,546 V279I probably benign Het
Kdm4b C T 17: 56,393,952 A541V probably benign Het
Kif14 A T 1: 136,468,438 T161S probably benign Het
Krt86 T C 15: 101,479,363 probably benign Het
Kyat1 C T 2: 30,187,186 probably null Het
Map3k11 T A 19: 5,695,846 M396K probably damaging Het
Mat2a A G 6: 72,436,195 probably null Het
Mbnl2 A G 14: 120,379,237 I88V possibly damaging Het
Mib2 T C 4: 155,655,673 T708A probably benign Het
Mkks T C 2: 136,877,606 probably null Het
Mtss1 T C 15: 58,944,017 M565V probably damaging Het
Myoc A G 1: 162,649,035 N436S probably damaging Het
Myod1 T A 7: 46,377,112 V147E probably damaging Het
Ngef A G 1: 87,509,334 L144P probably benign Het
Ngrn C T 7: 80,261,930 R92W probably damaging Het
Nup153 G A 13: 46,709,654 T349I probably benign Het
Olfr1211 T A 2: 88,930,283 I11L probably benign Het
Olfr600 G T 7: 103,346,204 S241R possibly damaging Het
Pigl A G 11: 62,503,748 I135M probably damaging Het
Pitpnm3 A G 11: 72,070,492 probably benign Het
Pkhd1 A T 1: 20,358,917 F2420I probably damaging Het
Polr2b C T 5: 77,320,076 T119M probably damaging Het
Prr29 A G 11: 106,376,896 Y130C probably damaging Het
Rab11fip3 T C 17: 25,990,999 I1048V probably damaging Het
Rab12 G A 17: 66,500,362 T124I probably damaging Het
Rab44 A G 17: 29,140,307 S490G probably benign Het
Rasa3 A G 8: 13,570,233 probably null Het
Rhbdl3 C T 11: 80,353,574 S369L possibly damaging Het
Rimbp2 A T 5: 128,788,356 S643T probably benign Het
Rin1 T G 19: 5,052,652 S396R probably damaging Het
Rpusd3 C T 6: 113,419,237 G28S probably damaging Het
Rtl9 T A X: 143,100,278 S229T probably damaging Het
Rufy1 G T 11: 50,389,852 T701N probably benign Het
Scn4a A T 11: 106,320,538 L1551* probably null Het
Sec24b T C 3: 129,988,984 N1119S probably null Het
Serbp1 T A 6: 67,272,884 *75R probably null Het
Setx C T 2: 29,179,673 P2497S probably benign Het
Slc26a11 A T 11: 119,359,314 I132F probably damaging Het
Slc4a1 A G 11: 102,352,684 V707A possibly damaging Het
Slfn1 A G 11: 83,121,843 I262V probably damaging Het
Tmem168 T A 6: 13,583,313 D523V possibly damaging Het
Traf7 G T 17: 24,510,551 Q469K probably benign Het
Trdmt1 C A 2: 13,544,617 V6F probably damaging Het
Tsacc A T 3: 88,287,088 probably benign Het
Vmn2r5 A G 3: 64,491,530 I589T possibly damaging Het
Vmn2r7 T C 3: 64,691,039 D699G probably damaging Het
Vmn2r82 T C 10: 79,381,295 V487A probably damaging Het
Zfp287 A T 11: 62,715,029 S351T probably benign Het
Zfp651 T C 9: 121,767,666 V696A probably damaging Het
Zfp654 T C 16: 64,785,688 H176R possibly damaging Het
Other mutations in Limch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Limch1 APN 5 66953679 missense probably damaging 0.99
IGL00644:Limch1 APN 5 67016552 missense probably benign 0.01
IGL00705:Limch1 APN 5 66993153 nonsense probably null
IGL01154:Limch1 APN 5 66745958 nonsense probably null 0.00
IGL01865:Limch1 APN 5 66974580 nonsense probably null
IGL02529:Limch1 APN 5 67002613 missense possibly damaging 0.89
IGL03171:Limch1 APN 5 67034194 missense possibly damaging 0.80
IGL03308:Limch1 APN 5 67002558 missense possibly damaging 0.92
IGL03396:Limch1 APN 5 66953673 missense probably damaging 1.00
R0067:Limch1 UTSW 5 66974622 missense probably damaging 0.99
R0067:Limch1 UTSW 5 66974622 missense probably damaging 0.99
R0114:Limch1 UTSW 5 67036084 intron probably benign
R0129:Limch1 UTSW 5 66959590 missense probably damaging 0.96
R0194:Limch1 UTSW 5 66999273 missense probably benign 0.05
R0367:Limch1 UTSW 5 66857954 critical splice donor site probably null
R0558:Limch1 UTSW 5 66969155 missense probably damaging 1.00
R0927:Limch1 UTSW 5 66997233 missense probably damaging 1.00
R1190:Limch1 UTSW 5 66969197 missense probably damaging 1.00
R1316:Limch1 UTSW 5 66999243 missense probably damaging 1.00
R1469:Limch1 UTSW 5 66881980 splice site probably benign
R1647:Limch1 UTSW 5 66999256 missense probably damaging 1.00
R1648:Limch1 UTSW 5 66999256 missense probably damaging 1.00
R1944:Limch1 UTSW 5 66999099 missense probably damaging 1.00
R2103:Limch1 UTSW 5 66998729 missense probably benign 0.05
R2126:Limch1 UTSW 5 67029760 missense probably damaging 1.00
R2248:Limch1 UTSW 5 67044399 missense probably damaging 1.00
R2415:Limch1 UTSW 5 66974634 missense probably damaging 1.00
R3762:Limch1 UTSW 5 67028840 missense probably damaging 1.00
R3797:Limch1 UTSW 5 66969079 missense probably damaging 1.00
R4659:Limch1 UTSW 5 67027557 missense probably damaging 1.00
R4773:Limch1 UTSW 5 67027507 missense probably damaging 0.99
R4876:Limch1 UTSW 5 66881927 missense possibly damaging 0.64
R5062:Limch1 UTSW 5 66969235 missense probably damaging 1.00
R5191:Limch1 UTSW 5 67027561 missense probably damaging 1.00
R5202:Limch1 UTSW 5 66993173 missense probably damaging 1.00
R5335:Limch1 UTSW 5 66881957 missense probably damaging 1.00
R5436:Limch1 UTSW 5 66974566 missense possibly damaging 0.72
R5994:Limch1 UTSW 5 66974622 missense probably damaging 1.00
R6049:Limch1 UTSW 5 67030860 missense probably benign 0.32
R6228:Limch1 UTSW 5 67016502 missense probably damaging 1.00
R6547:Limch1 UTSW 5 67028774 missense probably damaging 1.00
R6600:Limch1 UTSW 5 66745938 missense probably benign
R6888:Limch1 UTSW 5 67021926 missense probably benign 0.21
R7111:Limch1 UTSW 5 67025176 splice site probably null
R7132:Limch1 UTSW 5 66953685 missense probably damaging 1.00
R7144:Limch1 UTSW 5 67017658 missense probably benign 0.10
R7302:Limch1 UTSW 5 66959599 missense probably benign 0.02
R7341:Limch1 UTSW 5 67034202 missense probably benign 0.06
R7491:Limch1 UTSW 5 67054237 missense probably damaging 0.99
R8079:Limch1 UTSW 5 67046753 missense possibly damaging 0.73
R8229:Limch1 UTSW 5 67028795 missense probably damaging 1.00
R8348:Limch1 UTSW 5 67002482 missense probably damaging 0.98
R8395:Limch1 UTSW 5 66969051 missense probably damaging 0.96
R8416:Limch1 UTSW 5 66999306 missense probably benign
R8448:Limch1 UTSW 5 67002482 missense probably damaging 0.98
R8477:Limch1 UTSW 5 66974565 missense probably benign 0.01
R8924:Limch1 UTSW 5 67033132 missense probably benign 0.01
X0022:Limch1 UTSW 5 67021952 missense probably benign 0.00
X0027:Limch1 UTSW 5 67002620 missense probably damaging 1.00
Z1177:Limch1 UTSW 5 67028799 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGTGGCTAAGCACCACATGTTTC -3'
(R):5'- TGCCTGCACACAAAGCCTTGAC -3'

Sequencing Primer
(F):5'- TGGTTTCTGCCACCAAAGAG -3'
(R):5'- CCTTGACAGATGCATGAGTTTC -3'
Posted On2013-04-16