Mutagenetix > Incidental Mutation

Incidental Mutation 'R2096:Ctsl'

232129

Institutional Source

Beutler Lab

Gene Symbol

Ctsl

Ensembl Gene

ENSMUSG00000021477

Gene Name

cathepsin L

Synonyms

MEP, 1190035F06Rik, Cat L, major excreted protein

MMRRC Submission

040100-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2096 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

64509704-64518586 bp(-) (GRCm39)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 64516840 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000152169 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021933] [ENSMUST00000220737] [ENSMUST00000222462] [ENSMUST00000222517] [ENSMUST00000223494]

AlphaFold

P06797

Predicted Effect

probably null
Transcript: ENSMUST00000021933

SMART Domains

Protein: ENSMUSP00000021933
Gene: ENSMUSG00000021477

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
Inhibitor_I29	29	88	1.98e-23	SMART
Pept_C1	114	332	1.67e-128	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220617

Predicted Effect

probably null
Transcript: ENSMUST00000220737

Predicted Effect

probably null
Transcript: ENSMUST00000222462

Predicted Effect

probably null
Transcript: ENSMUST00000222517

Predicted Effect

probably benign
Transcript: ENSMUST00000222971

Predicted Effect

probably benign
Transcript: ENSMUST00000223494

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the peptidase C1 (papain) family of cysteine proteases. The encoded preproprotein is proteolytically processed to generate multiple protein products. These products include the activation peptide and the cathepsin L1 heavy and light chains. The mature enzyme appears to be important in embryonic development through its processing of histone H3 and may play a role in disease progression in a model of kidney disease. Homozygous knockout mice for this gene exhibit hair loss, skin thickening, bone and heart defects, and enhanced susceptibility to bacterial infection. A pseudogene of this gene has been identified in the genome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for mutant alleles may show partial or complete hair-loss, skin defects, impaired T cell maturation, dilated cardiomyopathy, and high postnatal mortality. Mutant males for some alleles show both normal and atrophic seminiferous tubules and reduced sperm production. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb10	A	G	8: 124,709,195 (GRCm39)	S120P	probably benign	Het
Actr3b	T	A	5: 26,036,743 (GRCm39)	Y185*	probably null	Het
Atg101	T	A	15: 101,188,382 (GRCm39)	H162Q	possibly damaging	Het
Btf3	T	A	13: 98,449,659 (GRCm39)	Q109L	possibly damaging	Het
Camk2d	G	A	3: 126,574,091 (GRCm39)	G166D	probably damaging	Het
Capn7	T	G	14: 31,071,844 (GRCm39)		probably null	Het
Cd209f	A	G	8: 4,155,537 (GRCm39)	V17A	probably benign	Het
Cenpf	A	G	1: 189,385,656 (GRCm39)	V2208A	possibly damaging	Het
Cnga1	C	T	5: 72,776,404 (GRCm39)	V20I	possibly damaging	Het
Comp	T	C	8: 70,828,713 (GRCm39)	C182R	probably damaging	Het
Cyp3a44	G	T	5: 145,725,215 (GRCm39)	Q329K	probably damaging	Het
Dcpp1	A	T	17: 24,099,971 (GRCm39)		probably null	Het
Dhx38	A	G	8: 110,280,891 (GRCm39)	V831A	probably damaging	Het
Dkk2	T	C	3: 131,791,858 (GRCm39)	M22T	probably benign	Het
Dnah2	C	T	11: 69,346,742 (GRCm39)	E2615K	probably damaging	Het
Dpy19l3	A	G	7: 35,426,713 (GRCm39)		probably null	Het
Gm12888	T	G	4: 121,176,655 (GRCm39)	I49L	probably benign	Het
Insyn2b	C	A	11: 34,352,936 (GRCm39)	S326Y	probably benign	Het
Kif15	T	A	9: 122,815,252 (GRCm39)	M194K	probably damaging	Het
Mael	G	T	1: 166,053,244 (GRCm39)	Q254K	probably benign	Het
Nek9	T	C	12: 85,361,322 (GRCm39)	D461G	probably benign	Het
Nlrp12	T	C	7: 3,281,825 (GRCm39)	N819S	probably benign	Het
Ntng1	T	A	3: 109,739,871 (GRCm39)	N390Y	probably damaging	Het
Or5g25	A	G	2: 85,478,434 (GRCm39)	I77T	probably benign	Het
P2ry14	C	T	3: 59,022,738 (GRCm39)	V250I	probably damaging	Het
Pcnx2	A	T	8: 126,485,987 (GRCm39)	D1870E	probably benign	Het
Phf2	T	A	13: 48,985,589 (GRCm39)	K64*	probably null	Het
Phip	T	C	9: 82,797,392 (GRCm39)	H537R	possibly damaging	Het
Ppa2	A	G	3: 133,032,445 (GRCm39)	T97A	probably damaging	Het
Psd	G	A	19: 46,313,088 (GRCm39)		probably null	Het
Psg23	T	A	7: 18,348,668 (GRCm39)	E46D	probably damaging	Het
Ptch1	T	G	13: 63,672,773 (GRCm39)	E944A	probably benign	Het
Rab11b	A	G	17: 33,967,976 (GRCm39)	Y74H	probably damaging	Het
Rfc3	A	T	5: 151,568,383 (GRCm39)	S194R	probably benign	Het
Sema4d	A	T	13: 51,864,037 (GRCm39)	I414N	probably damaging	Het
Serpinb1a	A	T	13: 33,031,437 (GRCm39)	D120E	probably damaging	Het
Snai2	T	A	16: 14,524,861 (GRCm39)	H122Q	possibly damaging	Het
Spats2l	T	C	1: 57,985,458 (GRCm39)	S504P	probably benign	Het
Sprr2j-ps	T	C	3: 92,326,412 (GRCm39)	S96P	unknown	Het
Sspo	G	T	6: 48,438,608 (GRCm39)	V1559L	probably benign	Het
Tas2r118	T	G	6: 23,969,912 (GRCm39)	I50L	possibly damaging	Het
Tdrd3	C	T	14: 87,743,788 (GRCm39)	Q573*	probably null	Het
Thoc2l	T	C	5: 104,667,835 (GRCm39)	S786P	possibly damaging	Het
Tlnrd1	G	A	7: 83,532,062 (GRCm39)	T123I	probably benign	Het
Tmem214	T	A	5: 31,033,714 (GRCm39)	L555H	probably damaging	Het
Tmprss12	T	A	15: 100,183,117 (GRCm39)	M153K	probably benign	Het
Tmprss9	G	A	10: 80,725,268 (GRCm39)	G410S	probably damaging	Het
Trpm6	T	A	19: 18,803,116 (GRCm39)	M853K	probably damaging	Het
Vmn1r35	A	G	6: 66,655,929 (GRCm39)	I247T	possibly damaging	Het
Zcchc7	C	A	4: 44,931,059 (GRCm39)	P404T	probably damaging	Het
Zzef1	T	C	11: 72,763,465 (GRCm39)	F1371L	probably benign	Het

Other mutations in Ctsl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Ctsl	APN	13	64,515,982 (GRCm39)	missense	probably damaging	1.00
IGL02895:Ctsl	APN	13	64,514,326 (GRCm39)	missense	probably damaging	0.97
mauvais	UTSW	13	64,511,916 (GRCm39)	splice site	probably null
patch	UTSW	13	64,514,437 (GRCm39)	nonsense	probably null
G1patch:Ctsl	UTSW	13	64,514,437 (GRCm39)	nonsense	probably null
R0518:Ctsl	UTSW	13	64,513,032 (GRCm39)	missense	possibly damaging	0.75
R0521:Ctsl	UTSW	13	64,513,032 (GRCm39)	missense	possibly damaging	0.75
R1546:Ctsl	UTSW	13	64,515,693 (GRCm39)	missense	probably damaging	1.00
R5690:Ctsl	UTSW	13	64,513,022 (GRCm39)	missense	probably damaging	1.00
R5804:Ctsl	UTSW	13	64,514,302 (GRCm39)	missense	probably damaging	1.00
R6182:Ctsl	UTSW	13	64,515,786 (GRCm39)	missense	probably damaging	0.99
R6670:Ctsl	UTSW	13	64,511,916 (GRCm39)	splice site	probably null
R6725:Ctsl	UTSW	13	64,514,437 (GRCm39)	nonsense	probably null
R6886:Ctsl	UTSW	13	64,512,961 (GRCm39)	splice site	probably null
R7502:Ctsl	UTSW	13	64,514,882 (GRCm39)	missense	probably damaging	1.00
R8828:Ctsl	UTSW	13	64,514,314 (GRCm39)	missense	probably damaging	1.00
R8947:Ctsl	UTSW	13	64,514,840 (GRCm39)	missense	probably damaging	1.00
R9354:Ctsl	UTSW	13	64,516,850 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTCTGGCTATAAACTTCTGAGGG -3'
(R):5'- GAAAGCTTCCGTGGGATTCTC -3'

Sequencing Primer
(F):5'- GGTGGCACATGACTTAAATCCTAGC -3'
(R):5'- GAAAGCTTCCGTGGGATTCTCATTTC -3'

Posted On

2014-09-18