Incidental Mutation 'R2096:Tdrd3'
ID 232132
Institutional Source Beutler Lab
Gene Symbol Tdrd3
Ensembl Gene ENSMUSG00000022019
Gene Name tudor domain containing 3
Synonyms 4732418C03Rik
MMRRC Submission 040100-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.335) question?
Stock # R2096 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 87416639-87545504 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 87506352 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 573 (Q573*)
Ref Sequence ENSEMBL: ENSMUSP00000126189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168275] [ENSMUST00000169504] [ENSMUST00000170865]
AlphaFold Q91W18
Predicted Effect probably null
Transcript: ENSMUST00000168275
AA Change: Q579*
SMART Domains Protein: ENSMUSP00000129019
Gene: ENSMUSG00000022019
AA Change: Q579*

DomainStartEndE-ValueType
DUF1767 6 88 4.85e-24 SMART
low complexity region 269 280 N/A INTRINSIC
UBA 288 325 1.67e-7 SMART
low complexity region 338 348 N/A INTRINSIC
low complexity region 446 460 N/A INTRINSIC
TUDOR 646 705 1.07e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000169504
AA Change: Q579*
SMART Domains Protein: ENSMUSP00000131542
Gene: ENSMUSG00000022019
AA Change: Q579*

DomainStartEndE-ValueType
DUF1767 6 88 4.85e-24 SMART
low complexity region 269 280 N/A INTRINSIC
UBA 288 325 1.67e-7 SMART
low complexity region 338 348 N/A INTRINSIC
low complexity region 446 460 N/A INTRINSIC
TUDOR 646 705 1.07e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000170865
AA Change: Q573*
SMART Domains Protein: ENSMUSP00000126189
Gene: ENSMUSG00000022019
AA Change: Q573*

DomainStartEndE-ValueType
DUF1767 3 82 1.36e-18 SMART
low complexity region 263 274 N/A INTRINSIC
UBA 282 319 1.67e-7 SMART
low complexity region 332 342 N/A INTRINSIC
low complexity region 440 454 N/A INTRINSIC
TUDOR 640 699 1.07e-7 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice for a hypomorphic allele show increased genomic instability, and increased c-Myc/Igh translocation and R loop formation in B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 A G 8: 123,982,456 S120P probably benign Het
Actr3b T A 5: 25,831,745 Y185* probably null Het
Atg101 T A 15: 101,290,501 H162Q possibly damaging Het
BC005561 T C 5: 104,519,969 S786P possibly damaging Het
Btf3 T A 13: 98,313,151 Q109L possibly damaging Het
Camk2d G A 3: 126,780,442 G166D probably damaging Het
Capn7 T G 14: 31,349,887 probably null Het
Cd209f A G 8: 4,105,537 V17A probably benign Het
Cenpf A G 1: 189,653,459 V2208A possibly damaging Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Comp T C 8: 70,376,063 C182R probably damaging Het
Ctsl A G 13: 64,369,026 probably null Het
Cyp3a44 G T 5: 145,788,405 Q329K probably damaging Het
Dcpp1 A T 17: 23,880,997 probably null Het
Dhx38 A G 8: 109,554,259 V831A probably damaging Het
Dkk2 T C 3: 132,086,097 M22T probably benign Het
Dnah2 C T 11: 69,455,916 E2615K probably damaging Het
Dpy19l3 A G 7: 35,727,288 probably null Het
Fam196b C A 11: 34,402,936 S326Y probably benign Het
Gm12888 T G 4: 121,319,458 I49L probably benign Het
Kif15 T A 9: 122,986,187 M194K probably damaging Het
Mael G T 1: 166,225,675 Q254K probably benign Het
Nek9 T C 12: 85,314,548 D461G probably benign Het
Nlrp12 T C 7: 3,233,195 N819S probably benign Het
Ntng1 T A 3: 109,832,555 N390Y probably damaging Het
Olfr1002 A G 2: 85,648,090 I77T probably benign Het
P2ry14 C T 3: 59,115,317 V250I probably damaging Het
Pcnx2 A T 8: 125,759,248 D1870E probably benign Het
Phf2 T A 13: 48,832,113 K64* probably null Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Ppa2 A G 3: 133,326,684 T97A probably damaging Het
Psd G A 19: 46,324,649 probably null Het
Psg23 T A 7: 18,614,743 E46D probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rab11b A G 17: 33,749,002 Y74H probably damaging Het
Rfc3 A T 5: 151,644,918 S194R probably benign Het
Sema4d A T 13: 51,710,001 I414N probably damaging Het
Serpinb1a A T 13: 32,847,454 D120E probably damaging Het
Snai2 T A 16: 14,706,997 H122Q possibly damaging Het
Spats2l T C 1: 57,946,299 S504P probably benign Het
Sprr2j-ps T C 3: 92,419,105 S96P unknown Het
Sspo G T 6: 48,461,674 V1559L probably benign Het
Tas2r118 T G 6: 23,969,913 I50L possibly damaging Het
Tlnrd1 G A 7: 83,882,854 T123I probably benign Het
Tmem214 T A 5: 30,876,370 L555H probably damaging Het
Tmprss12 T A 15: 100,285,236 M153K probably benign Het
Tmprss9 G A 10: 80,889,434 G410S probably damaging Het
Trpm6 T A 19: 18,825,752 M853K probably damaging Het
Vmn1r35 A G 6: 66,678,945 I247T possibly damaging Het
Zcchc7 C A 4: 44,931,059 P404T probably damaging Het
Zzef1 T C 11: 72,872,639 F1371L probably benign Het
Other mutations in Tdrd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Tdrd3 APN 14 87472182 missense probably damaging 1.00
IGL01339:Tdrd3 APN 14 87480794 missense possibly damaging 0.75
IGL01565:Tdrd3 APN 14 87472232 missense probably benign 0.01
IGL02505:Tdrd3 APN 14 87511682 missense probably damaging 1.00
R0121:Tdrd3 UTSW 14 87539479 missense probably damaging 1.00
R0550:Tdrd3 UTSW 14 87486220 missense probably damaging 1.00
R0648:Tdrd3 UTSW 14 87472182 missense probably damaging 1.00
R1080:Tdrd3 UTSW 14 87506398 missense probably benign 0.00
R1099:Tdrd3 UTSW 14 87487239 missense probably damaging 1.00
R1126:Tdrd3 UTSW 14 87480774 missense probably damaging 1.00
R1370:Tdrd3 UTSW 14 87458054 intron probably benign
R1592:Tdrd3 UTSW 14 87505886 missense probably damaging 1.00
R1881:Tdrd3 UTSW 14 87486347 splice site probably null
R2162:Tdrd3 UTSW 14 87480785 missense probably damaging 0.98
R3833:Tdrd3 UTSW 14 87480785 missense probably damaging 0.98
R3947:Tdrd3 UTSW 14 87506599 missense probably damaging 1.00
R4421:Tdrd3 UTSW 14 87486283 missense probably damaging 1.00
R4783:Tdrd3 UTSW 14 87472101 missense probably damaging 1.00
R4957:Tdrd3 UTSW 14 87505787 missense probably benign 0.06
R5212:Tdrd3 UTSW 14 87506215 missense probably damaging 0.98
R5291:Tdrd3 UTSW 14 87505798 missense probably benign 0.21
R5318:Tdrd3 UTSW 14 87477463 critical splice donor site probably null
R5383:Tdrd3 UTSW 14 87480791 nonsense probably null
R5718:Tdrd3 UTSW 14 87506440 missense probably benign 0.05
R6240:Tdrd3 UTSW 14 87505886 missense probably damaging 1.00
R6292:Tdrd3 UTSW 14 87506254 missense probably benign
R6532:Tdrd3 UTSW 14 87505816 missense probably damaging 0.98
R6850:Tdrd3 UTSW 14 87458079 intron probably benign
R6958:Tdrd3 UTSW 14 87457096 missense probably damaging 1.00
R7224:Tdrd3 UTSW 14 87477403 missense probably damaging 1.00
R7240:Tdrd3 UTSW 14 87458803 missense probably benign 0.06
R7565:Tdrd3 UTSW 14 87506593 nonsense probably null
R7818:Tdrd3 UTSW 14 87472200 missense probably damaging 1.00
R7861:Tdrd3 UTSW 14 87472154 missense probably damaging 1.00
R8108:Tdrd3 UTSW 14 87486266 missense possibly damaging 0.95
R8206:Tdrd3 UTSW 14 87511778 missense probably benign 0.11
R8383:Tdrd3 UTSW 14 87506308 missense probably benign 0.26
R8786:Tdrd3 UTSW 14 87472201 nonsense probably null
R8985:Tdrd3 UTSW 14 87506161 missense possibly damaging 0.69
R9081:Tdrd3 UTSW 14 87506281 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGCCCTTTGTATGCAGAGG -3'
(R):5'- ACACTTTTGCATACTCCACAGG -3'

Sequencing Primer
(F):5'- CCCTTTGTATGCAGAGGCCAAAG -3'
(R):5'- TGCATACTCCACAGGAATAGATG -3'
Posted On 2014-09-18