Incidental Mutation 'R2096:Tmprss12'
ID232134
Institutional Source Beutler Lab
Gene Symbol Tmprss12
Ensembl Gene ENSMUSG00000045631
Gene Nametransmembrane (C-terminal) protease, serine 12
Synonyms
MMRRC Submission 040100-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R2096 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location100280837-100293066 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100285236 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 153 (M153K)
Ref Sequence ENSEMBL: ENSMUSP00000093914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096200]
Predicted Effect probably benign
Transcript: ENSMUST00000096200
AA Change: M153K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000093914
Gene: ENSMUSG00000045631
AA Change: M153K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Tryp_SPc 65 301 1.82e-77 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230901
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 A G 8: 123,982,456 S120P probably benign Het
Actr3b T A 5: 25,831,745 Y185* probably null Het
Atg101 T A 15: 101,290,501 H162Q possibly damaging Het
BC005561 T C 5: 104,519,969 S786P possibly damaging Het
Btf3 T A 13: 98,313,151 Q109L possibly damaging Het
Camk2d G A 3: 126,780,442 G166D probably damaging Het
Capn7 T G 14: 31,349,887 probably null Het
Cd209f A G 8: 4,105,537 V17A probably benign Het
Cenpf A G 1: 189,653,459 V2208A possibly damaging Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Comp T C 8: 70,376,063 C182R probably damaging Het
Ctsl A G 13: 64,369,026 probably null Het
Cyp3a44 G T 5: 145,788,405 Q329K probably damaging Het
Dcpp1 A T 17: 23,880,997 probably null Het
Dhx38 A G 8: 109,554,259 V831A probably damaging Het
Dkk2 T C 3: 132,086,097 M22T probably benign Het
Dnah2 C T 11: 69,455,916 E2615K probably damaging Het
Dpy19l3 A G 7: 35,727,288 probably null Het
Fam196b C A 11: 34,402,936 S326Y probably benign Het
Gm12888 T G 4: 121,319,458 I49L probably benign Het
Kif15 T A 9: 122,986,187 M194K probably damaging Het
Mael G T 1: 166,225,675 Q254K probably benign Het
Nek9 T C 12: 85,314,548 D461G probably benign Het
Nlrp12 T C 7: 3,233,195 N819S probably benign Het
Ntng1 T A 3: 109,832,555 N390Y probably damaging Het
Olfr1002 A G 2: 85,648,090 I77T probably benign Het
P2ry14 C T 3: 59,115,317 V250I probably damaging Het
Pcnx2 A T 8: 125,759,248 D1870E probably benign Het
Phf2 T A 13: 48,832,113 K64* probably null Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Ppa2 A G 3: 133,326,684 T97A probably damaging Het
Psd G A 19: 46,324,649 probably null Het
Psg23 T A 7: 18,614,743 E46D probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rab11b A G 17: 33,749,002 Y74H probably damaging Het
Rfc3 A T 5: 151,644,918 S194R probably benign Het
Sema4d A T 13: 51,710,001 I414N probably damaging Het
Serpinb1a A T 13: 32,847,454 D120E probably damaging Het
Snai2 T A 16: 14,706,997 H122Q possibly damaging Het
Spats2l T C 1: 57,946,299 S504P probably benign Het
Sprr2j-ps T C 3: 92,419,105 S96P unknown Het
Sspo G T 6: 48,461,674 V1559L probably benign Het
Tas2r118 T G 6: 23,969,913 I50L possibly damaging Het
Tdrd3 C T 14: 87,506,352 Q573* probably null Het
Tlnrd1 G A 7: 83,882,854 T123I probably benign Het
Tmem214 T A 5: 30,876,370 L555H probably damaging Het
Tmprss9 G A 10: 80,889,434 G410S probably damaging Het
Trpm6 T A 19: 18,825,752 M853K probably damaging Het
Vmn1r35 A G 6: 66,678,945 I247T possibly damaging Het
Zcchc7 C A 4: 44,931,059 P404T probably damaging Het
Zzef1 T C 11: 72,872,639 F1371L probably benign Het
Other mutations in Tmprss12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02967:Tmprss12 APN 15 100285381 missense probably benign 0.31
IGL03080:Tmprss12 APN 15 100292648 missense probably damaging 1.00
R0497:Tmprss12 UTSW 15 100281039 splice site probably benign
R1035:Tmprss12 UTSW 15 100285200 missense probably benign 0.18
R1800:Tmprss12 UTSW 15 100292547 missense probably benign 0.27
R2851:Tmprss12 UTSW 15 100282415 missense possibly damaging 0.94
R4193:Tmprss12 UTSW 15 100289304 missense probably damaging 1.00
R6498:Tmprss12 UTSW 15 100285252 missense probably damaging 0.99
R6931:Tmprss12 UTSW 15 100285268 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTTTGTTGTCAGGCTGATATCTAG -3'
(R):5'- TCTACCAGCAAGCAGGAAGG -3'

Sequencing Primer
(F):5'- TGTCAGGCTGATATCTAGGGGAAATG -3'
(R):5'- GTCAGTCGGACTCAGACAATAGTTAC -3'
Posted On2014-09-18