Incidental Mutation 'R2107:Lamc2'
ID232143
Institutional Source Beutler Lab
Gene Symbol Lamc2
Ensembl Gene ENSMUSG00000026479
Gene Namelaminin, gamma 2
Synonymsnicein, 100kDa
MMRRC Submission 040111-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.762) question?
Stock #R2107 (G1)
Quality Score131
Status Validated
Chromosome1
Chromosomal Location153122756-153186447 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 153154386 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027753] [ENSMUST00000185356]
Predicted Effect probably benign
Transcript: ENSMUST00000027753
SMART Domains Protein: ENSMUSP00000027753
Gene: ENSMUSG00000026479

DomainStartEndE-ValueType
EGF_Lam 28 81 1.03e-7 SMART
EGF_Lam 84 128 2.14e-14 SMART
EGF_Lam 139 184 4.52e-13 SMART
LamB 245 370 7.58e-46 SMART
EGF_like 370 413 3.83e0 SMART
Blast:EGF_like 417 460 8e-23 BLAST
EGF_Lam 462 514 1.95e-8 SMART
EGF_Lam 517 570 1.88e-10 SMART
EGF_like 573 610 2.6e-1 SMART
coiled coil region 612 680 N/A INTRINSIC
low complexity region 792 817 N/A INTRINSIC
coiled coil region 952 994 N/A INTRINSIC
low complexity region 1016 1027 N/A INTRINSIC
coiled coil region 1039 1072 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185328
Predicted Effect probably benign
Transcript: ENSMUST00000185356
SMART Domains Protein: ENSMUSP00000140514
Gene: ENSMUSG00000026479

DomainStartEndE-ValueType
EGF_Lam 28 81 1.03e-7 SMART
EGF_Lam 84 128 2.14e-14 SMART
EGF_Lam 139 184 4.52e-13 SMART
LamB 245 370 7.58e-46 SMART
EGF_like 370 413 3.83e0 SMART
Blast:EGF_like 417 460 8e-23 BLAST
EGF_Lam 462 514 1.95e-8 SMART
EGF_Lam 517 570 1.88e-10 SMART
EGF_like 573 610 2.6e-1 SMART
coiled coil region 612 680 N/A INTRINSIC
low complexity region 792 817 N/A INTRINSIC
coiled coil region 952 994 N/A INTRINSIC
low complexity region 1016 1027 N/A INTRINSIC
coiled coil region 1039 1072 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188831
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 2. The gamma 2 chain, formerly thought to be a truncated version of beta chain (B2t), is highly homologous to the gamma 1 chain; however, it lacks domain VI, and domains V, IV and III are shorter. It is expressed in several fetal tissues but differently from gamma 1, and is specifically localized to epithelial cells in skin, lung and kidney. The gamma 2 chain together with alpha 3 and beta 3 chains constitute laminin 5 (earlier known as kalinin), which is an integral part of the anchoring filaments that connect epithelial cells to the underlying basement membrane. The epithelium-specific expression of the gamma 2 chain implied its role as an epithelium attachment molecule, and mutations in this gene have been associated with junctional epidermolysis bullosa, a skin disease characterized by blisters due to disruption of the epidermal-dermal junction. Two transcript variants resulting from alternative splicing of the 3' terminal exon, and encoding different isoforms of gamma 2 chain, have been described. The two variants are differentially expressed in embryonic tissues, however, the biological significance of the two forms is not known. Transcript variants utilizing alternative polyA_signal have also been noted in literature. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in cell:cell adhesion involving epithelial cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,795,732 L364Q probably damaging Het
9030624J02Rik T C 7: 118,794,539 probably benign Het
A2m C A 6: 121,654,612 L623M probably benign Het
Ace2 A G X: 164,140,732 N24S probably benign Het
Acp2 G A 2: 91,203,595 probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Bcas3 G A 11: 85,457,878 V199I probably damaging Het
Cblb T A 16: 52,152,716 probably null Het
Ccdc88c G T 12: 100,921,549 D1557E probably benign Het
Cdc20 T C 4: 118,433,513 Y430C probably damaging Het
Cdk5rap1 C T 2: 154,353,246 D350N probably benign Het
Cgrrf1 T A 14: 46,853,376 probably benign Het
Chia1 T A 3: 106,128,840 Y185* probably null Het
Cmtm8 A T 9: 114,796,108 V85D possibly damaging Het
Cplx4 A G 18: 65,956,893 S152P probably benign Het
Crmp1 G T 5: 37,242,494 R117L probably benign Het
Csad G C 15: 102,179,034 L365V probably null Het
Dyrk1a C T 16: 94,686,527 T532M probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam208a T A 14: 27,461,787 probably null Het
Fan1 T G 7: 64,366,788 R529S probably damaging Het
Fbln5 A G 12: 101,771,269 W173R probably damaging Het
Gm9611 A T 14: 42,294,654 N42K possibly damaging Het
Gnal T A 18: 67,213,578 L257Q probably damaging Het
Hint3 A T 10: 30,618,256 F33I probably damaging Het
Ipcef1 A G 10: 6,890,501 S403P probably benign Het
Kmt2c T C 5: 25,309,824 N3007S probably benign Het
Kpna3 T C 14: 61,370,484 D424G possibly damaging Het
Krt90 A G 15: 101,562,629 I66T probably benign Het
Lmtk3 G T 7: 45,793,969 C692F possibly damaging Het
Lrguk T C 6: 34,062,361 M269T probably benign Het
Lrrc19 T A 4: 94,639,294 T227S probably benign Het
Lrrk1 C A 7: 66,279,282 D1201Y probably damaging Het
Matn2 T A 15: 34,423,759 Y588N probably damaging Het
Mmp1b A G 9: 7,369,310 W346R probably damaging Het
Mpo T C 11: 87,796,075 Y177H probably damaging Het
Mprip A G 11: 59,769,891 K2166R probably damaging Het
Myo15 T C 11: 60,491,810 Y1544H probably damaging Het
Nav1 C T 1: 135,449,004 R1694Q probably damaging Het
Nedd9 A T 13: 41,338,979 C12* probably null Het
Neu1 G A 17: 34,934,398 R299Q probably benign Het
Nisch C T 14: 31,172,140 V172I probably damaging Het
Npy2r A T 3: 82,541,129 probably null Het
Ogg1 C A 6: 113,329,293 N150K probably damaging Het
Olfr350 C A 2: 36,850,343 A99E possibly damaging Het
Olfr59 T C 11: 74,289,390 V248A probably damaging Het
Olfr818 A G 10: 129,945,712 S2P probably damaging Het
Pck1 G C 2: 173,154,068 E120Q probably benign Het
Pde11a A G 2: 76,337,922 V229A probably damaging Het
Pias2 T C 18: 77,097,471 F83L probably benign Het
Plagl1 A C 10: 13,128,647 probably benign Het
Plin3 A T 17: 56,284,391 S130T probably benign Het
Rcc2 A G 4: 140,721,185 Y515C probably damaging Het
Rgs12 A G 5: 34,966,735 K621E possibly damaging Het
Rnf6 G A 5: 146,211,281 T309I probably damaging Het
Rpusd3 G T 6: 113,415,562 T335N probably damaging Het
Scn8a A T 15: 101,018,363 I1218F probably damaging Het
Slc23a1 T A 18: 35,625,826 Q104L possibly damaging Het
Slc34a3 A T 2: 25,230,987 V363D probably damaging Het
Smap1 A T 1: 23,848,454 M248K possibly damaging Het
Sp1 A G 15: 102,409,678 probably null Het
Tbc1d1 T G 5: 64,284,705 N689K probably benign Het
Tff2 T C 17: 31,142,282 E99G possibly damaging Het
Tjp3 T C 10: 81,280,544 N239D possibly damaging Het
Trim37 G A 11: 87,159,825 R230Q probably benign Het
Ubr5 A G 15: 37,989,302 M2090T probably benign Het
Unc13a T C 8: 71,656,251 probably null Het
Usp43 GC G 11: 67,855,740 probably null Het
Utrn C A 10: 12,436,364 D616Y probably damaging Het
Vav2 T C 2: 27,267,303 E829G probably damaging Het
Zfp26 A T 9: 20,442,237 D85E probably benign Het
Zfp292 A T 4: 34,808,593 F1484I possibly damaging Het
Other mutations in Lamc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Lamc2 APN 1 153130056 missense probably benign 0.00
IGL00907:Lamc2 APN 1 153144651 missense probably benign 0.32
IGL02026:Lamc2 APN 1 153144736 splice site probably benign
IGL02335:Lamc2 APN 1 153166216 missense probably benign 0.00
IGL02568:Lamc2 APN 1 153166262 missense possibly damaging 0.91
IGL02640:Lamc2 APN 1 153152057 missense probably damaging 0.99
IGL02801:Lamc2 APN 1 153136783 missense probably benign 0.10
IGL02827:Lamc2 APN 1 153139781 missense probably damaging 1.00
IGL03240:Lamc2 APN 1 153124125 missense probably damaging 1.00
IGL03245:Lamc2 APN 1 153133757 splice site probably null
ANU74:Lamc2 UTSW 1 153131835 missense probably benign 0.00
R0279:Lamc2 UTSW 1 153130696 missense probably benign 0.01
R0528:Lamc2 UTSW 1 153124094 missense probably damaging 1.00
R0597:Lamc2 UTSW 1 153133621 missense probably benign 0.02
R0650:Lamc2 UTSW 1 153143876 missense possibly damaging 0.88
R0826:Lamc2 UTSW 1 153152082 missense probably damaging 1.00
R1015:Lamc2 UTSW 1 153166199 missense possibly damaging 0.53
R1172:Lamc2 UTSW 1 153166287 missense probably damaging 1.00
R1308:Lamc2 UTSW 1 153150818 missense probably damaging 1.00
R1521:Lamc2 UTSW 1 153166263 missense probably benign 0.11
R1525:Lamc2 UTSW 1 153130756 missense probably benign 0.00
R1602:Lamc2 UTSW 1 153127028 missense probably benign 0.00
R1631:Lamc2 UTSW 1 153158934 missense possibly damaging 0.95
R1633:Lamc2 UTSW 1 153141698 nonsense probably null
R1832:Lamc2 UTSW 1 153166187 missense possibly damaging 0.72
R1978:Lamc2 UTSW 1 153133597 critical splice donor site probably null
R1996:Lamc2 UTSW 1 153154470 missense possibly damaging 0.84
R2046:Lamc2 UTSW 1 153141765 missense probably benign 0.01
R2130:Lamc2 UTSW 1 153127124 missense probably damaging 1.00
R2182:Lamc2 UTSW 1 153126866 missense possibly damaging 0.46
R2207:Lamc2 UTSW 1 153133706 missense possibly damaging 0.68
R2218:Lamc2 UTSW 1 153130779 missense probably benign 0.21
R3772:Lamc2 UTSW 1 153124251 missense probably benign
R4616:Lamc2 UTSW 1 153166169 missense probably damaging 1.00
R4874:Lamc2 UTSW 1 153154395 missense probably null 1.00
R4939:Lamc2 UTSW 1 153126836 missense probably damaging 1.00
R4985:Lamc2 UTSW 1 153136805 missense probably benign
R5544:Lamc2 UTSW 1 153124053 missense possibly damaging 0.93
R5632:Lamc2 UTSW 1 153131890 missense probably damaging 1.00
R5771:Lamc2 UTSW 1 153141594 missense probably benign 0.04
R5811:Lamc2 UTSW 1 153166253 missense possibly damaging 0.53
R6058:Lamc2 UTSW 1 153136829 missense probably benign 0.01
R6130:Lamc2 UTSW 1 153136777 missense probably benign 0.01
R6137:Lamc2 UTSW 1 153166153 missense possibly damaging 0.90
R6994:Lamc2 UTSW 1 153136762 missense probably benign 0.18
R6995:Lamc2 UTSW 1 153136762 missense probably benign 0.18
R6997:Lamc2 UTSW 1 153136762 missense probably benign 0.18
R7000:Lamc2 UTSW 1 153166127 missense possibly damaging 0.72
R7018:Lamc2 UTSW 1 153136742 missense probably benign 0.00
R7145:Lamc2 UTSW 1 153130772 missense possibly damaging 0.95
R7148:Lamc2 UTSW 1 153185984 missense probably benign 0.01
R7171:Lamc2 UTSW 1 153139749 missense probably damaging 1.00
R7640:Lamc2 UTSW 1 153136804 missense possibly damaging 0.79
R7673:Lamc2 UTSW 1 153124036 missense probably damaging 1.00
R7684:Lamc2 UTSW 1 153127025 missense probably null 0.86
R7712:Lamc2 UTSW 1 153133611 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GCCTTGCATCTAAGCACCTG -3'
(R):5'- CGTGTCTGACTGTGAAGTGC -3'

Sequencing Primer
(F):5'- TTGCATCTAAGCACCTGGGAGTC -3'
(R):5'- TCTGACTGTGAAGTGCTGGAAAC -3'
Posted On2014-09-18