Mutagenetix > Incidental Mutations

Incidental Mutation 'R2107:Olfr350'

232147

Institutional Source

Beutler Lab

Gene Symbol

Olfr350

Ensembl Gene

ENSMUSG00000050015

Gene Name

olfactory receptor 350

Synonyms

MOR136-13, GA_x6K02T2NLDC-33544602-33545540

MMRRC Submission

040111-MU

Accession Numbers

Genbank: NM_146627; MGI: 3030184

Is this an essential gene?

Probably non essential (E-score: 0.175) question?

Stock #

R2107 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

36846310-36851702 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 36850343 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Glutamic Acid at position 99 (A99E)

Ref Sequence

ENSEMBL: ENSMUSP00000149667 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055130] [ENSMUST00000214457] [ENSMUST00000215100]

AlphaFold

Q8VFP8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000055130
AA Change: A99E

PolyPhen 2 Score 0.540 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000053105
Gene: ENSMUSG00000050015
AA Change: A99E

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	6.3e-61	PFAM
Pfam:7TM_GPCR_Srsx	35	305	1.3e-7	PFAM
Pfam:7tm_1	41	290	3e-24	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000214457
AA Change: A99E

PolyPhen 2 Score 0.540 (Sensitivity: 0.88; Specificity: 0.90)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000215100
AA Change: A99E

PolyPhen 2 Score 0.540 (Sensitivity: 0.88; Specificity: 0.90)

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001O22Rik	A	T	2: 30,795,732	L364Q	probably damaging	Het
9030624J02Rik	T	C	7: 118,794,539		probably benign	Het
A2m	C	A	6: 121,654,612	L623M	probably benign	Het
Ace2	A	G	X: 164,140,732	N24S	probably benign	Het
Acp2	G	A	2: 91,203,595		probably benign	Het
Akap8l	C	T	17: 32,332,483	R511H	probably damaging	Het
Bcas3	G	A	11: 85,457,878	V199I	probably damaging	Het
Cblb	T	A	16: 52,152,716		probably null	Het
Ccdc88c	G	T	12: 100,921,549	D1557E	probably benign	Het
Cdc20	T	C	4: 118,433,513	Y430C	probably damaging	Het
Cdk5rap1	C	T	2: 154,353,246	D350N	probably benign	Het
Cgrrf1	T	A	14: 46,853,376		probably benign	Het
Chia1	T	A	3: 106,128,840	Y185*	probably null	Het
Cmtm8	A	T	9: 114,796,108	V85D	possibly damaging	Het
Cplx4	A	G	18: 65,956,893	S152P	probably benign	Het
Crmp1	G	T	5: 37,242,494	R117L	probably benign	Het
Csad	G	C	15: 102,179,034	L365V	probably null	Het
Dyrk1a	C	T	16: 94,686,527	T532M	probably damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam208a	T	A	14: 27,461,787		probably null	Het
Fan1	T	G	7: 64,366,788	R529S	probably damaging	Het
Fbln5	A	G	12: 101,771,269	W173R	probably damaging	Het
Gm9611	A	T	14: 42,294,654	N42K	possibly damaging	Het
Gnal	T	A	18: 67,213,578	L257Q	probably damaging	Het
Hint3	A	T	10: 30,618,256	F33I	probably damaging	Het
Ipcef1	A	G	10: 6,890,501	S403P	probably benign	Het
Kmt2c	T	C	5: 25,309,824	N3007S	probably benign	Het
Kpna3	T	C	14: 61,370,484	D424G	possibly damaging	Het
Krt90	A	G	15: 101,562,629	I66T	probably benign	Het
Lamc2	A	G	1: 153,154,386		probably benign	Het
Lmtk3	G	T	7: 45,793,969	C692F	possibly damaging	Het
Lrguk	T	C	6: 34,062,361	M269T	probably benign	Het
Lrrc19	T	A	4: 94,639,294	T227S	probably benign	Het
Lrrk1	C	A	7: 66,279,282	D1201Y	probably damaging	Het
Matn2	T	A	15: 34,423,759	Y588N	probably damaging	Het
Mmp1b	A	G	9: 7,369,310	W346R	probably damaging	Het
Mpo	T	C	11: 87,796,075	Y177H	probably damaging	Het
Mprip	A	G	11: 59,769,891	K2166R	probably damaging	Het
Myo15	T	C	11: 60,491,810	Y1544H	probably damaging	Het
Nav1	C	T	1: 135,449,004	R1694Q	probably damaging	Het
Nedd9	A	T	13: 41,338,979	C12*	probably null	Het
Neu1	G	A	17: 34,934,398	R299Q	probably benign	Het
Nisch	C	T	14: 31,172,140	V172I	probably damaging	Het
Npy2r	A	T	3: 82,541,129		probably null	Het
Ogg1	C	A	6: 113,329,293	N150K	probably damaging	Het
Olfr59	T	C	11: 74,289,390	V248A	probably damaging	Het
Olfr818	A	G	10: 129,945,712	S2P	probably damaging	Het
Pck1	G	C	2: 173,154,068	E120Q	probably benign	Het
Pde11a	A	G	2: 76,337,922	V229A	probably damaging	Het
Pias2	T	C	18: 77,097,471	F83L	probably benign	Het
Plagl1	A	C	10: 13,128,647		probably benign	Het
Plin3	A	T	17: 56,284,391	S130T	probably benign	Het
Rcc2	A	G	4: 140,721,185	Y515C	probably damaging	Het
Rgs12	A	G	5: 34,966,735	K621E	possibly damaging	Het
Rnf6	G	A	5: 146,211,281	T309I	probably damaging	Het
Rpusd3	G	T	6: 113,415,562	T335N	probably damaging	Het
Scn8a	A	T	15: 101,018,363	I1218F	probably damaging	Het
Slc23a1	T	A	18: 35,625,826	Q104L	possibly damaging	Het
Slc34a3	A	T	2: 25,230,987	V363D	probably damaging	Het
Smap1	A	T	1: 23,848,454	M248K	possibly damaging	Het
Sp1	A	G	15: 102,409,678		probably null	Het
Tbc1d1	T	G	5: 64,284,705	N689K	probably benign	Het
Tff2	T	C	17: 31,142,282	E99G	possibly damaging	Het
Tjp3	T	C	10: 81,280,544	N239D	possibly damaging	Het
Trim37	G	A	11: 87,159,825	R230Q	probably benign	Het
Ubr5	A	G	15: 37,989,302	M2090T	probably benign	Het
Unc13a	T	C	8: 71,656,251		probably null	Het
Usp43	GC	G	11: 67,855,740		probably null	Het
Utrn	C	A	10: 12,436,364	D616Y	probably damaging	Het
Vav2	T	C	2: 27,267,303	E829G	probably damaging	Het
Zfp26	A	T	9: 20,442,237	D85E	probably benign	Het
Zfp292	A	T	4: 34,808,593	F1484I	possibly damaging	Het

Other mutations in Olfr350

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01068:Olfr350	APN	2	36850270	missense	probably damaging	1.00
IGL01113:Olfr350	APN	2	36850619	missense	probably damaging	1.00
IGL01393:Olfr350	APN	2	36850541	missense	probably benign	0.01
IGL02302:Olfr350	APN	2	36850703	missense	probably benign	0.02
IGL02316:Olfr350	APN	2	36850282	missense	probably damaging	1.00
BB007:Olfr350	UTSW	2	36850273	missense	probably damaging	1.00
BB017:Olfr350	UTSW	2	36850273	missense	probably damaging	1.00
F6893:Olfr350	UTSW	2	36850807	missense	probably benign	0.00
PIT4402001:Olfr350	UTSW	2	36850304	missense	probably benign
R0312:Olfr350	UTSW	2	36850360	missense	probably benign	0.01
R0525:Olfr350	UTSW	2	36850190	missense	probably damaging	1.00
R0557:Olfr350	UTSW	2	36850748	missense	possibly damaging	0.95
R0665:Olfr350	UTSW	2	36850190	missense	probably damaging	1.00
R2019:Olfr350	UTSW	2	36850406	missense	possibly damaging	0.95
R2108:Olfr350	UTSW	2	36850343	missense	possibly damaging	0.54
R2848:Olfr350	UTSW	2	36850799	missense	probably damaging	1.00
R3964:Olfr350	UTSW	2	36850717	missense	probably benign	0.12
R4822:Olfr350	UTSW	2	36850876	missense	probably benign	0.10
R4907:Olfr350	UTSW	2	36850258	missense	probably benign	0.28
R5134:Olfr350	UTSW	2	36850476	missense	probably benign	0.03
R5144:Olfr350	UTSW	2	36850144	missense	probably benign
R5702:Olfr350	UTSW	2	36850934	missense	probably damaging	1.00
R5727:Olfr350	UTSW	2	36850532	missense	possibly damaging	0.80
R5786:Olfr350	UTSW	2	36850049	start codon destroyed	probably null	0.98
R6179:Olfr350	UTSW	2	36850834	missense	possibly damaging	0.59
R6862:Olfr350	UTSW	2	36850222	missense	possibly damaging	0.95
R7258:Olfr350	UTSW	2	36850340	missense	probably damaging	0.99
R7307:Olfr350	UTSW	2	36850125	missense	probably benign	0.00
R7353:Olfr350	UTSW	2	36850069	missense	probably benign
R7412:Olfr350	UTSW	2	36850466	missense	probably benign	0.28
R7851:Olfr350	UTSW	2	36850416	nonsense	probably null
R7930:Olfr350	UTSW	2	36850273	missense	probably damaging	1.00
R8005:Olfr350	UTSW	2	36850144	missense	probably benign
R8346:Olfr350	UTSW	2	36850339	missense	probably benign	0.02
R8692:Olfr350	UTSW	2	36850084	missense	probably benign	0.00
R9120:Olfr350	UTSW	2	36850131	nonsense	probably null
R9318:Olfr350	UTSW	2	36850553	missense	probably benign	0.12
Z1177:Olfr350	UTSW	2	36850239	missense	probably damaging	0.99
Z1177:Olfr350	UTSW	2	36850925	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGACAACTGTGCTGGGGAAC -3'
(R):5'- GTCAGCACAGAAGGATAGCC -3'

Sequencing Primer
(F):5'- GGAACCTGCTCATCATCCTAC -3'
(R):5'- CACAGAAGGATAGCCGGGCC -3'

Posted On

2014-09-18