Incidental Mutation 'R2107:Olfr350'
ID 232147
Institutional Source Beutler Lab
Gene Symbol Olfr350
Ensembl Gene ENSMUSG00000050015
Gene Name olfactory receptor 350
Synonyms MOR136-13, GA_x6K02T2NLDC-33544602-33545540
MMRRC Submission 040111-MU
Accession Numbers

Genbank: NM_146627; MGI: 3030184

Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock # R2107 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 36846310-36851702 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 36850343 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 99 (A99E)
Ref Sequence ENSEMBL: ENSMUSP00000149667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055130] [ENSMUST00000214457] [ENSMUST00000215100]
AlphaFold Q8VFP8
Predicted Effect possibly damaging
Transcript: ENSMUST00000055130
AA Change: A99E

PolyPhen 2 Score 0.540 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000053105
Gene: ENSMUSG00000050015
AA Change: A99E

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.3e-61 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.3e-7 PFAM
Pfam:7tm_1 41 290 3e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214457
AA Change: A99E

PolyPhen 2 Score 0.540 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215100
AA Change: A99E

PolyPhen 2 Score 0.540 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,795,732 L364Q probably damaging Het
9030624J02Rik T C 7: 118,794,539 probably benign Het
A2m C A 6: 121,654,612 L623M probably benign Het
Ace2 A G X: 164,140,732 N24S probably benign Het
Acp2 G A 2: 91,203,595 probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Bcas3 G A 11: 85,457,878 V199I probably damaging Het
Cblb T A 16: 52,152,716 probably null Het
Ccdc88c G T 12: 100,921,549 D1557E probably benign Het
Cdc20 T C 4: 118,433,513 Y430C probably damaging Het
Cdk5rap1 C T 2: 154,353,246 D350N probably benign Het
Cgrrf1 T A 14: 46,853,376 probably benign Het
Chia1 T A 3: 106,128,840 Y185* probably null Het
Cmtm8 A T 9: 114,796,108 V85D possibly damaging Het
Cplx4 A G 18: 65,956,893 S152P probably benign Het
Crmp1 G T 5: 37,242,494 R117L probably benign Het
Csad G C 15: 102,179,034 L365V probably null Het
Dyrk1a C T 16: 94,686,527 T532M probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam208a T A 14: 27,461,787 probably null Het
Fan1 T G 7: 64,366,788 R529S probably damaging Het
Fbln5 A G 12: 101,771,269 W173R probably damaging Het
Gm9611 A T 14: 42,294,654 N42K possibly damaging Het
Gnal T A 18: 67,213,578 L257Q probably damaging Het
Hint3 A T 10: 30,618,256 F33I probably damaging Het
Ipcef1 A G 10: 6,890,501 S403P probably benign Het
Kmt2c T C 5: 25,309,824 N3007S probably benign Het
Kpna3 T C 14: 61,370,484 D424G possibly damaging Het
Krt90 A G 15: 101,562,629 I66T probably benign Het
Lamc2 A G 1: 153,154,386 probably benign Het
Lmtk3 G T 7: 45,793,969 C692F possibly damaging Het
Lrguk T C 6: 34,062,361 M269T probably benign Het
Lrrc19 T A 4: 94,639,294 T227S probably benign Het
Lrrk1 C A 7: 66,279,282 D1201Y probably damaging Het
Matn2 T A 15: 34,423,759 Y588N probably damaging Het
Mmp1b A G 9: 7,369,310 W346R probably damaging Het
Mpo T C 11: 87,796,075 Y177H probably damaging Het
Mprip A G 11: 59,769,891 K2166R probably damaging Het
Myo15 T C 11: 60,491,810 Y1544H probably damaging Het
Nav1 C T 1: 135,449,004 R1694Q probably damaging Het
Nedd9 A T 13: 41,338,979 C12* probably null Het
Neu1 G A 17: 34,934,398 R299Q probably benign Het
Nisch C T 14: 31,172,140 V172I probably damaging Het
Npy2r A T 3: 82,541,129 probably null Het
Ogg1 C A 6: 113,329,293 N150K probably damaging Het
Olfr59 T C 11: 74,289,390 V248A probably damaging Het
Olfr818 A G 10: 129,945,712 S2P probably damaging Het
Pck1 G C 2: 173,154,068 E120Q probably benign Het
Pde11a A G 2: 76,337,922 V229A probably damaging Het
Pias2 T C 18: 77,097,471 F83L probably benign Het
Plagl1 A C 10: 13,128,647 probably benign Het
Plin3 A T 17: 56,284,391 S130T probably benign Het
Rcc2 A G 4: 140,721,185 Y515C probably damaging Het
Rgs12 A G 5: 34,966,735 K621E possibly damaging Het
Rnf6 G A 5: 146,211,281 T309I probably damaging Het
Rpusd3 G T 6: 113,415,562 T335N probably damaging Het
Scn8a A T 15: 101,018,363 I1218F probably damaging Het
Slc23a1 T A 18: 35,625,826 Q104L possibly damaging Het
Slc34a3 A T 2: 25,230,987 V363D probably damaging Het
Smap1 A T 1: 23,848,454 M248K possibly damaging Het
Sp1 A G 15: 102,409,678 probably null Het
Tbc1d1 T G 5: 64,284,705 N689K probably benign Het
Tff2 T C 17: 31,142,282 E99G possibly damaging Het
Tjp3 T C 10: 81,280,544 N239D possibly damaging Het
Trim37 G A 11: 87,159,825 R230Q probably benign Het
Ubr5 A G 15: 37,989,302 M2090T probably benign Het
Unc13a T C 8: 71,656,251 probably null Het
Usp43 GC G 11: 67,855,740 probably null Het
Utrn C A 10: 12,436,364 D616Y probably damaging Het
Vav2 T C 2: 27,267,303 E829G probably damaging Het
Zfp26 A T 9: 20,442,237 D85E probably benign Het
Zfp292 A T 4: 34,808,593 F1484I possibly damaging Het
Other mutations in Olfr350
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Olfr350 APN 2 36850270 missense probably damaging 1.00
IGL01113:Olfr350 APN 2 36850619 missense probably damaging 1.00
IGL01393:Olfr350 APN 2 36850541 missense probably benign 0.01
IGL02302:Olfr350 APN 2 36850703 missense probably benign 0.02
IGL02316:Olfr350 APN 2 36850282 missense probably damaging 1.00
BB007:Olfr350 UTSW 2 36850273 missense probably damaging 1.00
BB017:Olfr350 UTSW 2 36850273 missense probably damaging 1.00
F6893:Olfr350 UTSW 2 36850807 missense probably benign 0.00
PIT4402001:Olfr350 UTSW 2 36850304 missense probably benign
R0312:Olfr350 UTSW 2 36850360 missense probably benign 0.01
R0525:Olfr350 UTSW 2 36850190 missense probably damaging 1.00
R0557:Olfr350 UTSW 2 36850748 missense possibly damaging 0.95
R0665:Olfr350 UTSW 2 36850190 missense probably damaging 1.00
R2019:Olfr350 UTSW 2 36850406 missense possibly damaging 0.95
R2108:Olfr350 UTSW 2 36850343 missense possibly damaging 0.54
R2848:Olfr350 UTSW 2 36850799 missense probably damaging 1.00
R3964:Olfr350 UTSW 2 36850717 missense probably benign 0.12
R4822:Olfr350 UTSW 2 36850876 missense probably benign 0.10
R4907:Olfr350 UTSW 2 36850258 missense probably benign 0.28
R5134:Olfr350 UTSW 2 36850476 missense probably benign 0.03
R5144:Olfr350 UTSW 2 36850144 missense probably benign
R5702:Olfr350 UTSW 2 36850934 missense probably damaging 1.00
R5727:Olfr350 UTSW 2 36850532 missense possibly damaging 0.80
R5786:Olfr350 UTSW 2 36850049 start codon destroyed probably null 0.98
R6179:Olfr350 UTSW 2 36850834 missense possibly damaging 0.59
R6862:Olfr350 UTSW 2 36850222 missense possibly damaging 0.95
R7258:Olfr350 UTSW 2 36850340 missense probably damaging 0.99
R7307:Olfr350 UTSW 2 36850125 missense probably benign 0.00
R7353:Olfr350 UTSW 2 36850069 missense probably benign
R7412:Olfr350 UTSW 2 36850466 missense probably benign 0.28
R7851:Olfr350 UTSW 2 36850416 nonsense probably null
R7930:Olfr350 UTSW 2 36850273 missense probably damaging 1.00
R8005:Olfr350 UTSW 2 36850144 missense probably benign
R8346:Olfr350 UTSW 2 36850339 missense probably benign 0.02
R8692:Olfr350 UTSW 2 36850084 missense probably benign 0.00
R9120:Olfr350 UTSW 2 36850131 nonsense probably null
R9318:Olfr350 UTSW 2 36850553 missense probably benign 0.12
Z1177:Olfr350 UTSW 2 36850239 missense probably damaging 0.99
Z1177:Olfr350 UTSW 2 36850925 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACAACTGTGCTGGGGAAC -3'
(R):5'- GTCAGCACAGAAGGATAGCC -3'

Sequencing Primer
(F):5'- GGAACCTGCTCATCATCCTAC -3'
(R):5'- CACAGAAGGATAGCCGGGCC -3'
Posted On 2014-09-18