Incidental Mutation 'R2107:Chia1'
ID232153
Institutional Source Beutler Lab
Gene Symbol Chia1
Ensembl Gene ENSMUSG00000062778
Gene Namechitinase, acidic 1
Synonyms2200003E03Rik, YNL, AMCase, Chia
MMRRC Submission 040111-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.550) question?
Stock #R2107 (G1)
Quality Score215
Status Validated
Chromosome3
Chromosomal Location106113229-106132120 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 106128840 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 185 (Y185*)
Ref Sequence ENSEMBL: ENSMUSP00000121967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079132] [ENSMUST00000139086]
Predicted Effect probably null
Transcript: ENSMUST00000079132
AA Change: Y245*
SMART Domains Protein: ENSMUSP00000078134
Gene: ENSMUSG00000062778
AA Change: Y245*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 365 1.82e-161 SMART
ChtBD2 425 473 2.06e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000139086
AA Change: Y185*
SMART Domains Protein: ENSMUSP00000121967
Gene: ENSMUSG00000062778
AA Change: Y185*

DomainStartEndE-ValueType
Glyco_18 3 215 2.24e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143128
Meta Mutation Damage Score 0.9705 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene degrades chitin, which is found in the cell wall of most fungi as well as in arthropods and some nematodes. The encoded protein can also stimulate interleukin 13 expression, and variations in this gene can lead to asthma susceptibility. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,795,732 L364Q probably damaging Het
9030624J02Rik T C 7: 118,794,539 probably benign Het
A2m C A 6: 121,654,612 L623M probably benign Het
Ace2 A G X: 164,140,732 N24S probably benign Het
Acp2 G A 2: 91,203,595 probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Bcas3 G A 11: 85,457,878 V199I probably damaging Het
Cblb T A 16: 52,152,716 probably null Het
Ccdc88c G T 12: 100,921,549 D1557E probably benign Het
Cdc20 T C 4: 118,433,513 Y430C probably damaging Het
Cdk5rap1 C T 2: 154,353,246 D350N probably benign Het
Cgrrf1 T A 14: 46,853,376 probably benign Het
Cmtm8 A T 9: 114,796,108 V85D possibly damaging Het
Cplx4 A G 18: 65,956,893 S152P probably benign Het
Crmp1 G T 5: 37,242,494 R117L probably benign Het
Csad G C 15: 102,179,034 L365V probably null Het
Dyrk1a C T 16: 94,686,527 T532M probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam208a T A 14: 27,461,787 probably null Het
Fan1 T G 7: 64,366,788 R529S probably damaging Het
Fbln5 A G 12: 101,771,269 W173R probably damaging Het
Gm9611 A T 14: 42,294,654 N42K possibly damaging Het
Gnal T A 18: 67,213,578 L257Q probably damaging Het
Hint3 A T 10: 30,618,256 F33I probably damaging Het
Ipcef1 A G 10: 6,890,501 S403P probably benign Het
Kmt2c T C 5: 25,309,824 N3007S probably benign Het
Kpna3 T C 14: 61,370,484 D424G possibly damaging Het
Krt90 A G 15: 101,562,629 I66T probably benign Het
Lamc2 A G 1: 153,154,386 probably benign Het
Lmtk3 G T 7: 45,793,969 C692F possibly damaging Het
Lrguk T C 6: 34,062,361 M269T probably benign Het
Lrrc19 T A 4: 94,639,294 T227S probably benign Het
Lrrk1 C A 7: 66,279,282 D1201Y probably damaging Het
Matn2 T A 15: 34,423,759 Y588N probably damaging Het
Mmp1b A G 9: 7,369,310 W346R probably damaging Het
Mpo T C 11: 87,796,075 Y177H probably damaging Het
Mprip A G 11: 59,769,891 K2166R probably damaging Het
Myo15 T C 11: 60,491,810 Y1544H probably damaging Het
Nav1 C T 1: 135,449,004 R1694Q probably damaging Het
Nedd9 A T 13: 41,338,979 C12* probably null Het
Neu1 G A 17: 34,934,398 R299Q probably benign Het
Nisch C T 14: 31,172,140 V172I probably damaging Het
Npy2r A T 3: 82,541,129 probably null Het
Ogg1 C A 6: 113,329,293 N150K probably damaging Het
Olfr350 C A 2: 36,850,343 A99E possibly damaging Het
Olfr59 T C 11: 74,289,390 V248A probably damaging Het
Olfr818 A G 10: 129,945,712 S2P probably damaging Het
Pck1 G C 2: 173,154,068 E120Q probably benign Het
Pde11a A G 2: 76,337,922 V229A probably damaging Het
Pias2 T C 18: 77,097,471 F83L probably benign Het
Plagl1 A C 10: 13,128,647 probably benign Het
Plin3 A T 17: 56,284,391 S130T probably benign Het
Rcc2 A G 4: 140,721,185 Y515C probably damaging Het
Rgs12 A G 5: 34,966,735 K621E possibly damaging Het
Rnf6 G A 5: 146,211,281 T309I probably damaging Het
Rpusd3 G T 6: 113,415,562 T335N probably damaging Het
Scn8a A T 15: 101,018,363 I1218F probably damaging Het
Slc23a1 T A 18: 35,625,826 Q104L possibly damaging Het
Slc34a3 A T 2: 25,230,987 V363D probably damaging Het
Smap1 A T 1: 23,848,454 M248K possibly damaging Het
Sp1 A G 15: 102,409,678 probably null Het
Tbc1d1 T G 5: 64,284,705 N689K probably benign Het
Tff2 T C 17: 31,142,282 E99G possibly damaging Het
Tjp3 T C 10: 81,280,544 N239D possibly damaging Het
Trim37 G A 11: 87,159,825 R230Q probably benign Het
Ubr5 A G 15: 37,989,302 M2090T probably benign Het
Unc13a T C 8: 71,656,251 probably null Het
Usp43 GC G 11: 67,855,740 probably null Het
Utrn C A 10: 12,436,364 D616Y probably damaging Het
Vav2 T C 2: 27,267,303 E829G probably damaging Het
Zfp26 A T 9: 20,442,237 D85E probably benign Het
Zfp292 A T 4: 34,808,593 F1484I possibly damaging Het
Other mutations in Chia1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01917:Chia1 APN 3 106128220 missense probably damaging 1.00
Pet UTSW 3 106129022 critical splice donor site probably null
R0004:Chia1 UTSW 3 106129009 missense probably damaging 1.00
R0011:Chia1 UTSW 3 106130974 unclassified probably benign
R0047:Chia1 UTSW 3 106115257 missense probably damaging 0.99
R0345:Chia1 UTSW 3 106122439 missense probably damaging 1.00
R0456:Chia1 UTSW 3 106128479 missense probably damaging 1.00
R0638:Chia1 UTSW 3 106128437 splice site probably benign
R0847:Chia1 UTSW 3 106131937 missense probably benign 0.12
R1055:Chia1 UTSW 3 106130883 missense probably damaging 1.00
R1401:Chia1 UTSW 3 106128939 missense probably benign 0.00
R1513:Chia1 UTSW 3 106131904 missense probably benign 0.44
R1846:Chia1 UTSW 3 106130865 missense probably damaging 0.98
R1882:Chia1 UTSW 3 106128474 missense probably damaging 1.00
R1914:Chia1 UTSW 3 106128559 missense probably benign 0.06
R1915:Chia1 UTSW 3 106128559 missense probably benign 0.06
R3969:Chia1 UTSW 3 106121635 splice site probably null
R3970:Chia1 UTSW 3 106121635 splice site probably null
R4112:Chia1 UTSW 3 106128528 missense probably damaging 1.00
R4432:Chia1 UTSW 3 106115325 missense probably benign 0.03
R4625:Chia1 UTSW 3 106128940 missense probably benign 0.00
R4748:Chia1 UTSW 3 106122449 missense probably damaging 1.00
R5805:Chia1 UTSW 3 106128476 missense probably damaging 0.98
R5906:Chia1 UTSW 3 106131988 missense probably benign 0.01
R6173:Chia1 UTSW 3 106129022 critical splice donor site probably null
R6214:Chia1 UTSW 3 106122445 missense probably damaging 1.00
R6215:Chia1 UTSW 3 106122445 missense probably damaging 1.00
R6225:Chia1 UTSW 3 106130897 missense possibly damaging 0.66
R6383:Chia1 UTSW 3 106131811 missense probably benign
R6423:Chia1 UTSW 3 106128988 missense possibly damaging 0.60
R6668:Chia1 UTSW 3 106130948 missense probably damaging 1.00
R6764:Chia1 UTSW 3 106130740 critical splice donor site probably null
R7030:Chia1 UTSW 3 106115325 missense probably damaging 1.00
R7221:Chia1 UTSW 3 106131920 missense probably damaging 1.00
R7265:Chia1 UTSW 3 106128923 missense probably damaging 1.00
R7343:Chia1 UTSW 3 106132015 makesense probably null
R7420:Chia1 UTSW 3 106130664 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTACAGAAATGCACACTGGGG -3'
(R):5'- ATAGTAGGCCCAGAACCCAG -3'

Sequencing Primer
(F):5'- CAGGCTCCAGATTAATGTTAGTTCAG -3'
(R):5'- CAGCCTGTCTGGTATAGGGC -3'
Posted On2014-09-18