Incidental Mutation 'R2107:Rnf6'
ID232162
Institutional Source Beutler Lab
Gene Symbol Rnf6
Ensembl Gene ENSMUSG00000029634
Gene Namering finger protein (C3H2C3 type) 6
Synonyms5730419H05Rik, 1200013I08Rik
MMRRC Submission 040111-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.674) question?
Stock #R2107 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location146209192-146221555 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 146211281 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 309 (T309I)
Ref Sequence ENSEMBL: ENSMUSP00000128774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067837] [ENSMUST00000159074] [ENSMUST00000161331] [ENSMUST00000161574] [ENSMUST00000161859] [ENSMUST00000169407]
Predicted Effect probably damaging
Transcript: ENSMUST00000067837
AA Change: T309I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000067559
Gene: ENSMUSG00000029634
AA Change: T309I

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 79 95 N/A INTRINSIC
low complexity region 187 215 N/A INTRINSIC
low complexity region 513 530 N/A INTRINSIC
RING 614 654 6.68e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159074
SMART Domains Protein: ENSMUSP00000123926
Gene: ENSMUSG00000029634

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
low complexity region 90 106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161331
SMART Domains Protein: ENSMUSP00000125611
Gene: ENSMUSG00000029634

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 79 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161574
SMART Domains Protein: ENSMUSP00000123730
Gene: ENSMUSG00000029634

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
low complexity region 90 106 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161859
AA Change: T309I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124293
Gene: ENSMUSG00000029634
AA Change: T309I

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 79 95 N/A INTRINSIC
low complexity region 187 215 N/A INTRINSIC
low complexity region 513 530 N/A INTRINSIC
RING 614 654 6.68e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162219
SMART Domains Protein: ENSMUSP00000123708
Gene: ENSMUSG00000029634

DomainStartEndE-ValueType
low complexity region 49 65 N/A INTRINSIC
low complexity region 157 185 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169407
AA Change: T309I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128774
Gene: ENSMUSG00000029634
AA Change: T309I

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 79 95 N/A INTRINSIC
low complexity region 187 215 N/A INTRINSIC
low complexity region 513 530 N/A INTRINSIC
RING 614 654 6.68e-6 SMART
Meta Mutation Damage Score 0.174 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING-H2 finger motif. Deletions and mutations in this gene were detected in esophageal squamous cell carcinoma (ESCC), suggesting that this protein may be a potential tumor suppressor. Studies of the mouse counterpart suggested a role of this protein in the transcription regulation that controls germinal differentiation. Multiple alternatively spliced transcript variants encoding the same protein are observed. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,795,732 L364Q probably damaging Het
9030624J02Rik T C 7: 118,794,539 probably benign Het
A2m C A 6: 121,654,612 L623M probably benign Het
Ace2 A G X: 164,140,732 N24S probably benign Het
Acp2 G A 2: 91,203,595 probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Bcas3 G A 11: 85,457,878 V199I probably damaging Het
Cblb T A 16: 52,152,716 probably null Het
Ccdc88c G T 12: 100,921,549 D1557E probably benign Het
Cdc20 T C 4: 118,433,513 Y430C probably damaging Het
Cdk5rap1 C T 2: 154,353,246 D350N probably benign Het
Cgrrf1 T A 14: 46,853,376 probably benign Het
Chia1 T A 3: 106,128,840 Y185* probably null Het
Cmtm8 A T 9: 114,796,108 V85D possibly damaging Het
Cplx4 A G 18: 65,956,893 S152P probably benign Het
Crmp1 G T 5: 37,242,494 R117L probably benign Het
Csad G C 15: 102,179,034 L365V probably null Het
Dyrk1a C T 16: 94,686,527 T532M probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam208a T A 14: 27,461,787 probably null Het
Fan1 T G 7: 64,366,788 R529S probably damaging Het
Fbln5 A G 12: 101,771,269 W173R probably damaging Het
Gm9611 A T 14: 42,294,654 N42K possibly damaging Het
Gnal T A 18: 67,213,578 L257Q probably damaging Het
Hint3 A T 10: 30,618,256 F33I probably damaging Het
Ipcef1 A G 10: 6,890,501 S403P probably benign Het
Kmt2c T C 5: 25,309,824 N3007S probably benign Het
Kpna3 T C 14: 61,370,484 D424G possibly damaging Het
Krt90 A G 15: 101,562,629 I66T probably benign Het
Lamc2 A G 1: 153,154,386 probably benign Het
Lmtk3 G T 7: 45,793,969 C692F possibly damaging Het
Lrguk T C 6: 34,062,361 M269T probably benign Het
Lrrc19 T A 4: 94,639,294 T227S probably benign Het
Lrrk1 C A 7: 66,279,282 D1201Y probably damaging Het
Matn2 T A 15: 34,423,759 Y588N probably damaging Het
Mmp1b A G 9: 7,369,310 W346R probably damaging Het
Mpo T C 11: 87,796,075 Y177H probably damaging Het
Mprip A G 11: 59,769,891 K2166R probably damaging Het
Myo15 T C 11: 60,491,810 Y1544H probably damaging Het
Nav1 C T 1: 135,449,004 R1694Q probably damaging Het
Nedd9 A T 13: 41,338,979 C12* probably null Het
Neu1 G A 17: 34,934,398 R299Q probably benign Het
Nisch C T 14: 31,172,140 V172I probably damaging Het
Npy2r A T 3: 82,541,129 probably null Het
Ogg1 C A 6: 113,329,293 N150K probably damaging Het
Olfr350 C A 2: 36,850,343 A99E possibly damaging Het
Olfr59 T C 11: 74,289,390 V248A probably damaging Het
Olfr818 A G 10: 129,945,712 S2P probably damaging Het
Pck1 G C 2: 173,154,068 E120Q probably benign Het
Pde11a A G 2: 76,337,922 V229A probably damaging Het
Pias2 T C 18: 77,097,471 F83L probably benign Het
Plagl1 A C 10: 13,128,647 probably benign Het
Plin3 A T 17: 56,284,391 S130T probably benign Het
Rcc2 A G 4: 140,721,185 Y515C probably damaging Het
Rgs12 A G 5: 34,966,735 K621E possibly damaging Het
Rpusd3 G T 6: 113,415,562 T335N probably damaging Het
Scn8a A T 15: 101,018,363 I1218F probably damaging Het
Slc23a1 T A 18: 35,625,826 Q104L possibly damaging Het
Slc34a3 A T 2: 25,230,987 V363D probably damaging Het
Smap1 A T 1: 23,848,454 M248K possibly damaging Het
Sp1 A G 15: 102,409,678 probably null Het
Tbc1d1 T G 5: 64,284,705 N689K probably benign Het
Tff2 T C 17: 31,142,282 E99G possibly damaging Het
Tjp3 T C 10: 81,280,544 N239D possibly damaging Het
Trim37 G A 11: 87,159,825 R230Q probably benign Het
Ubr5 A G 15: 37,989,302 M2090T probably benign Het
Unc13a T C 8: 71,656,251 probably null Het
Usp43 GC G 11: 67,855,740 probably null Het
Utrn C A 10: 12,436,364 D616Y probably damaging Het
Vav2 T C 2: 27,267,303 E829G probably damaging Het
Zfp26 A T 9: 20,442,237 D85E probably benign Het
Zfp292 A T 4: 34,808,593 F1484I possibly damaging Het
Other mutations in Rnf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Rnf6 APN 5 146211905 missense possibly damaging 0.86
IGL01432:Rnf6 APN 5 146216121 missense possibly damaging 0.61
IGL01722:Rnf6 APN 5 146210226 missense probably benign
IGL01866:Rnf6 APN 5 146210907 missense probably damaging 0.99
R0141:Rnf6 UTSW 5 146211835 missense possibly damaging 0.95
R0551:Rnf6 UTSW 5 146211395 missense possibly damaging 0.65
R0619:Rnf6 UTSW 5 146210721 missense possibly damaging 0.58
R0685:Rnf6 UTSW 5 146211658 missense probably damaging 0.99
R1363:Rnf6 UTSW 5 146211559 missense probably benign
R1387:Rnf6 UTSW 5 146211245 missense probably benign 0.00
R1671:Rnf6 UTSW 5 146211188 nonsense probably null
R2047:Rnf6 UTSW 5 146211864 missense probably damaging 0.99
R2074:Rnf6 UTSW 5 146210906 missense probably damaging 0.98
R2871:Rnf6 UTSW 5 146210405 missense probably benign 0.07
R2871:Rnf6 UTSW 5 146210405 missense probably benign 0.07
R2873:Rnf6 UTSW 5 146210405 missense probably benign 0.07
R2874:Rnf6 UTSW 5 146210405 missense probably benign 0.07
R4361:Rnf6 UTSW 5 146211279 missense probably damaging 1.00
R5421:Rnf6 UTSW 5 146210529 missense probably benign 0.06
R5437:Rnf6 UTSW 5 146210280 missense probably damaging 1.00
R5614:Rnf6 UTSW 5 146218100 splice site probably null
R5848:Rnf6 UTSW 5 146211149 missense probably benign 0.25
R7515:Rnf6 UTSW 5 146211792 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTGCAGGTCCAGTGTGATTG -3'
(R):5'- TACTCTCAGGCAAGGTGGAC -3'

Sequencing Primer
(F):5'- TGAGGACCTGCTAGACTCTC -3'
(R):5'- ACGGCAGCGGTTTGGAG -3'
Posted On2014-09-18