Incidental Mutation 'R2107:Lrguk'
ID 232163
Institutional Source Beutler Lab
Gene Symbol Lrguk
Ensembl Gene ENSMUSG00000056215
Gene Name leucine-rich repeats and guanylate kinase domain containing
Synonyms 4921528H16Rik
MMRRC Submission 040111-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R2107 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 34006379-34110969 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34039296 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 269 (M269T)
Ref Sequence ENSEMBL: ENSMUSP00000153993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070189] [ENSMUST00000228187]
AlphaFold Q9D5S7
Predicted Effect probably benign
Transcript: ENSMUST00000070189
AA Change: M269T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000065146
Gene: ENSMUSG00000056215
AA Change: M269T

DomainStartEndE-ValueType
coiled coil region 75 113 N/A INTRINSIC
LRR 148 170 2.69e2 SMART
LRR 236 258 1.86e2 SMART
LRR 279 301 1.99e0 SMART
LRR 326 349 1.58e2 SMART
GuKc 414 600 6.84e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000228187
AA Change: M269T

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,685,744 (GRCm39) L364Q probably damaging Het
A2m C A 6: 121,631,571 (GRCm39) L623M probably benign Het
Ace2 A G X: 162,923,728 (GRCm39) N24S probably benign Het
Acp2 G A 2: 91,033,940 (GRCm39) probably benign Het
Akap8l C T 17: 32,551,457 (GRCm39) R511H probably damaging Het
Bcas3 G A 11: 85,348,704 (GRCm39) V199I probably damaging Het
Cblb T A 16: 51,973,079 (GRCm39) probably null Het
Ccdc88c G T 12: 100,887,808 (GRCm39) D1557E probably benign Het
Cdc20 T C 4: 118,290,710 (GRCm39) Y430C probably damaging Het
Cdk5rap1 C T 2: 154,195,166 (GRCm39) D350N probably benign Het
Cgrrf1 T A 14: 47,090,833 (GRCm39) probably benign Het
Chia1 T A 3: 106,036,156 (GRCm39) Y185* probably null Het
Cmtm8 A T 9: 114,625,176 (GRCm39) V85D possibly damaging Het
Cplx4 A G 18: 66,089,964 (GRCm39) S152P probably benign Het
Crmp1 G T 5: 37,399,838 (GRCm39) R117L probably benign Het
Csad G C 15: 102,087,469 (GRCm39) L365V probably null Het
Dyrk1a C T 16: 94,487,386 (GRCm39) T532M probably damaging Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fan1 T G 7: 64,016,536 (GRCm39) R529S probably damaging Het
Fbln5 A G 12: 101,737,528 (GRCm39) W173R probably damaging Het
Gm9611 A T 14: 42,116,611 (GRCm39) N42K possibly damaging Het
Gnal T A 18: 67,346,649 (GRCm39) L257Q probably damaging Het
Hint3 A T 10: 30,494,252 (GRCm39) F33I probably damaging Het
Ipcef1 A G 10: 6,840,501 (GRCm39) S403P probably benign Het
Kmt2c T C 5: 25,514,822 (GRCm39) N3007S probably benign Het
Kpna3 T C 14: 61,607,933 (GRCm39) D424G possibly damaging Het
Krt90 A G 15: 101,471,064 (GRCm39) I66T probably benign Het
Lamc2 A G 1: 153,030,132 (GRCm39) probably benign Het
Lmtk3 G T 7: 45,443,393 (GRCm39) C692F possibly damaging Het
Lrrc19 T A 4: 94,527,531 (GRCm39) T227S probably benign Het
Lrrk1 C A 7: 65,929,030 (GRCm39) D1201Y probably damaging Het
Matn2 T A 15: 34,423,905 (GRCm39) Y588N probably damaging Het
Mmp1b A G 9: 7,369,310 (GRCm39) W346R probably damaging Het
Mpo T C 11: 87,686,901 (GRCm39) Y177H probably damaging Het
Mprip A G 11: 59,660,717 (GRCm39) K2166R probably damaging Het
Myo15a T C 11: 60,382,636 (GRCm39) Y1544H probably damaging Het
Nav1 C T 1: 135,376,742 (GRCm39) R1694Q probably damaging Het
Nedd9 A T 13: 41,492,455 (GRCm39) C12* probably null Het
Neu1 G A 17: 35,153,374 (GRCm39) R299Q probably benign Het
Nisch C T 14: 30,894,097 (GRCm39) V172I probably damaging Het
Npy2r A T 3: 82,448,436 (GRCm39) probably null Het
Ogg1 C A 6: 113,306,254 (GRCm39) N150K probably damaging Het
Or1j4 C A 2: 36,740,355 (GRCm39) A99E possibly damaging Het
Or1p1 T C 11: 74,180,216 (GRCm39) V248A probably damaging Het
Or6c219 A G 10: 129,781,581 (GRCm39) S2P probably damaging Het
Pck1 G C 2: 172,995,861 (GRCm39) E120Q probably benign Het
Pde11a A G 2: 76,168,266 (GRCm39) V229A probably damaging Het
Pias2 T C 18: 77,185,167 (GRCm39) F83L probably benign Het
Plagl1 A C 10: 13,004,391 (GRCm39) probably benign Het
Plin3 A T 17: 56,591,391 (GRCm39) S130T probably benign Het
Rcc2 A G 4: 140,448,496 (GRCm39) Y515C probably damaging Het
Rgs12 A G 5: 35,124,079 (GRCm39) K621E possibly damaging Het
Rnf6 G A 5: 146,148,091 (GRCm39) T309I probably damaging Het
Rpusd3 G T 6: 113,392,523 (GRCm39) T335N probably damaging Het
Scn8a A T 15: 100,916,244 (GRCm39) I1218F probably damaging Het
Slc23a1 T A 18: 35,758,879 (GRCm39) Q104L possibly damaging Het
Slc34a3 A T 2: 25,120,999 (GRCm39) V363D probably damaging Het
Smap1 A T 1: 23,887,535 (GRCm39) M248K possibly damaging Het
Sp1 A G 15: 102,318,113 (GRCm39) probably null Het
Tasor T A 14: 27,183,744 (GRCm39) probably null Het
Tbc1d1 T G 5: 64,442,048 (GRCm39) N689K probably benign Het
Tff2 T C 17: 31,361,256 (GRCm39) E99G possibly damaging Het
Tjp3 T C 10: 81,116,378 (GRCm39) N239D possibly damaging Het
Trim37 G A 11: 87,050,651 (GRCm39) R230Q probably benign Het
Ubr5 A G 15: 37,989,546 (GRCm39) M2090T probably benign Het
Unc13a T C 8: 72,108,895 (GRCm39) probably null Het
Usp43 GC G 11: 67,746,566 (GRCm39) probably null Het
Utrn C A 10: 12,312,108 (GRCm39) D616Y probably damaging Het
Vav2 T C 2: 27,157,315 (GRCm39) E829G probably damaging Het
Vps35l T C 7: 118,393,762 (GRCm39) probably benign Het
Zfp26 A T 9: 20,353,533 (GRCm39) D85E probably benign Het
Zfp292 A T 4: 34,808,593 (GRCm39) F1484I possibly damaging Het
Other mutations in Lrguk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Lrguk APN 6 34,020,364 (GRCm39) missense probably damaging 1.00
IGL00566:Lrguk APN 6 34,033,109 (GRCm39) missense probably damaging 1.00
IGL01720:Lrguk APN 6 34,020,412 (GRCm39) missense probably damaging 1.00
IGL02325:Lrguk APN 6 34,106,114 (GRCm39) missense probably benign 0.31
IGL02484:Lrguk APN 6 34,069,726 (GRCm39) missense probably damaging 1.00
IGL02493:Lrguk APN 6 34,106,127 (GRCm39) missense probably benign 0.03
IGL02636:Lrguk APN 6 34,067,123 (GRCm39) missense probably damaging 1.00
IGL03278:Lrguk APN 6 34,093,381 (GRCm39) missense possibly damaging 0.80
R0031:Lrguk UTSW 6 34,020,431 (GRCm39) missense probably damaging 0.99
R1069:Lrguk UTSW 6 34,025,818 (GRCm39) missense possibly damaging 0.63
R1487:Lrguk UTSW 6 34,039,295 (GRCm39) missense probably benign 0.01
R1568:Lrguk UTSW 6 34,063,373 (GRCm39) missense probably damaging 1.00
R1604:Lrguk UTSW 6 34,049,305 (GRCm39) missense possibly damaging 0.67
R1847:Lrguk UTSW 6 34,110,322 (GRCm39) missense possibly damaging 0.52
R2045:Lrguk UTSW 6 34,048,003 (GRCm39) missense probably damaging 1.00
R2125:Lrguk UTSW 6 34,069,837 (GRCm39) missense probably benign 0.05
R2136:Lrguk UTSW 6 34,020,454 (GRCm39) missense probably benign 0.00
R2997:Lrguk UTSW 6 34,050,697 (GRCm39) missense probably damaging 0.98
R3847:Lrguk UTSW 6 34,050,703 (GRCm39) missense probably damaging 1.00
R3849:Lrguk UTSW 6 34,050,703 (GRCm39) missense probably damaging 1.00
R4626:Lrguk UTSW 6 34,106,158 (GRCm39) missense probably benign 0.00
R4718:Lrguk UTSW 6 34,006,431 (GRCm39) missense probably benign 0.02
R4778:Lrguk UTSW 6 34,033,015 (GRCm39) missense probably damaging 1.00
R4841:Lrguk UTSW 6 34,069,802 (GRCm39) missense probably damaging 0.98
R5324:Lrguk UTSW 6 34,050,732 (GRCm39) missense possibly damaging 0.87
R5450:Lrguk UTSW 6 34,047,996 (GRCm39) missense probably damaging 1.00
R5741:Lrguk UTSW 6 34,025,802 (GRCm39) missense probably damaging 0.99
R5939:Lrguk UTSW 6 34,055,688 (GRCm39) missense probably damaging 1.00
R5997:Lrguk UTSW 6 34,106,078 (GRCm39) missense probably damaging 0.99
R6786:Lrguk UTSW 6 34,072,522 (GRCm39) missense probably benign 0.11
R6802:Lrguk UTSW 6 34,039,392 (GRCm39) missense probably damaging 1.00
R7081:Lrguk UTSW 6 34,079,074 (GRCm39) missense probably benign 0.01
R7303:Lrguk UTSW 6 34,006,411 (GRCm39) missense probably benign 0.00
R7316:Lrguk UTSW 6 34,080,191 (GRCm39) missense unknown
R7473:Lrguk UTSW 6 34,006,630 (GRCm39) missense probably benign 0.01
R7543:Lrguk UTSW 6 34,025,870 (GRCm39) nonsense probably null
R7613:Lrguk UTSW 6 34,078,683 (GRCm39) missense possibly damaging 0.68
R7716:Lrguk UTSW 6 34,072,474 (GRCm39) missense probably damaging 1.00
R7900:Lrguk UTSW 6 34,106,129 (GRCm39) missense probably benign 0.01
R8012:Lrguk UTSW 6 34,033,038 (GRCm39) missense probably benign 0.00
R8251:Lrguk UTSW 6 34,093,374 (GRCm39) missense probably benign 0.00
R8324:Lrguk UTSW 6 34,079,506 (GRCm39) missense probably benign 0.03
R8551:Lrguk UTSW 6 34,093,446 (GRCm39) missense probably damaging 0.96
R8828:Lrguk UTSW 6 34,080,572 (GRCm39) missense unknown
R8879:Lrguk UTSW 6 34,006,618 (GRCm39) missense probably benign 0.00
X0057:Lrguk UTSW 6 34,055,682 (GRCm39) missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- AGTTAGTTGCCTGGCTTTCC -3'
(R):5'- TCCGCTTCCTGAAATCACGC -3'

Sequencing Primer
(F):5'- GCCTGGCTTTCCTACTGACTTAAAAG -3'
(R):5'- GCTTCCTGAAATCACGCCCTAC -3'
Posted On 2014-09-18