Mutagenetix > Incidental Mutation

Incidental Mutation 'R0193:Cadps2'

23217

Institutional Source

Beutler Lab

Gene Symbol

Cadps2

Ensembl Gene

ENSMUSG00000017978

Gene Name

Ca2+-dependent activator protein for secretion 2

Synonyms

Caps2, cpd2, A230044C21Rik

MMRRC Submission

038452-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0193 (G1)

Quality Score

202

Status

Validated (trace)

Chromosome

Chromosomal Location

23262773-23839421 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 23599440 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 260 (K260R)

Ref Sequence

ENSEMBL: ENSMUSP00000125972 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000069074] [ENSMUST00000115356] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000142913] [ENSMUST00000163871] [ENSMUST00000166458]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000018122
AA Change: K289R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978
AA Change: K289R

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	1.14e-52	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000069074
AA Change: K289R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978
AA Change: K289R

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	895	5.54e-51	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000115356
AA Change: K289R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000111013
Gene: ENSMUSG00000017978
AA Change: K289R

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000115358
AA Change: K289R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978
AA Change: K289R

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	1.14e-52	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000115361
AA Change: K289R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978
AA Change: K289R

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	892	1.9e-49	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136279

Predicted Effect

probably benign
Transcript: ENSMUST00000142913
AA Change: K260R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978
AA Change: K260R

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	22	39	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
coiled coil region	236	256	N/A	INTRINSIC
C2	340	438	1.51e-1	SMART
PH	463	567	2.94e-11	SMART
DUF1041	772	873	1.14e-52	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000163871
AA Change: K289R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978
AA Change: K289R

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	7.2e-50	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000166458
AA Change: K260R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978
AA Change: K260R

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
coiled coil region	236	256	N/A	INTRINSIC
C2	340	438	1.51e-1	SMART
PH	463	567	2.94e-11	SMART
DUF1041	772	873	1.05e-51	SMART

Meta Mutation Damage Score

0.0594

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 94.7%
20x: 85.3%

Validation Efficiency

95% (186/196)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in cerebellum, Purkinje cell and interneuron morphology, paired-pulse facilitation, and behaviors including emotional behavior, vestibuoocular reflex, circadium and sleep patterns, social investigation and nurturing behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330182L06Rik	A	T	5: 9,422,359	Q352L	probably damaging	Het
Adgrb1	T	C	15: 74,572,156	S96P	probably damaging	Het
Akr1c20	A	G	13: 4,511,293		probably benign	Het
Atp2a3	G	T	11: 72,972,220	V99L	possibly damaging	Het
Atp6v0a1	T	A	11: 101,048,482	I691N	possibly damaging	Het
Atp8b1	C	T	18: 64,561,636	R525Q	probably benign	Het
Aurkb	A	G	11: 69,048,544	D151G	probably damaging	Het
Bank1	A	T	3: 136,066,518		probably benign	Het
Bcl9l	T	C	9: 44,507,406	L847P	probably damaging	Het
Bscl2	T	A	19: 8,847,429	M292K	probably benign	Het
Cacna1c	C	T	6: 118,602,402		probably benign	Het
Cc2d2a	T	C	5: 43,736,118	S1419P	probably damaging	Het
Ccdc180	G	A	4: 45,914,803	E145K	probably benign	Het
Ccdc58	T	C	16: 36,082,814	S59P	probably damaging	Het
Ccno	C	T	13: 112,988,884		probably benign	Het
Cd300a	A	G	11: 114,893,376	D70G	probably benign	Het
Cenpc1	T	C	5: 86,032,403	D670G	probably benign	Het
Cenpl	A	G	1: 161,085,988	I323V	probably damaging	Het
Cfap44	A	G	16: 44,449,210		probably null	Het
Cfap74	C	T	4: 155,426,115	R386C	probably benign	Het
Cic	T	A	7: 25,287,140	S1299T	probably damaging	Het
Cic	C	A	7: 25,287,141	S1299Y	probably damaging	Het
Clcnkb	T	C	4: 141,412,316	E125G	possibly damaging	Het
Clstn1	G	A	4: 149,634,796	V361M	probably damaging	Het
Coro7	G	A	16: 4,627,504		probably benign	Het
Dchs1	C	T	7: 105,764,983	R875H	probably benign	Het
Eif3j1	A	C	2: 122,052,027	M239L	probably benign	Het
Eif4g3	G	T	4: 138,146,376		probably benign	Het
Erbb4	T	C	1: 68,043,960		probably benign	Het
Erlin2	T	G	8: 27,031,764	V164G	possibly damaging	Het
Fbxo43	G	T	15: 36,161,883	Q393K	probably benign	Het
Fcgr4	A	T	1: 171,025,760	N178I	possibly damaging	Het
Grid2	A	G	6: 64,063,953	N293S	possibly damaging	Het
H2-M1	C	T	17: 36,671,332	V126I	probably benign	Het
Htr1f	T	A	16: 64,926,749	Y60F	probably damaging	Het
Ilf2	A	G	3: 90,481,339		probably null	Het
Impg2	A	T	16: 56,265,049	K931*	probably null	Het
Ints1	T	C	5: 139,751,730	E2176G	probably damaging	Het
Iqsec2	T	C	X: 152,223,403	V1319A	probably benign	Het
Iqsec3	G	T	6: 121,410,724	D685E	probably damaging	Het
Itgbl1	G	A	14: 123,846,546	V279I	probably benign	Het
Kdm4b	C	T	17: 56,393,952	A541V	probably benign	Het
Kif14	A	T	1: 136,468,438	T161S	probably benign	Het
Krt86	T	C	15: 101,479,363		probably benign	Het
Kyat1	C	T	2: 30,187,186		probably null	Het
Limch1	T	C	5: 67,027,539	W791R	probably damaging	Het
Map3k11	T	A	19: 5,695,846	M396K	probably damaging	Het
Mat2a	A	G	6: 72,436,195		probably null	Het
Mbnl2	A	G	14: 120,379,237	I88V	possibly damaging	Het
Mib2	T	C	4: 155,655,673	T708A	probably benign	Het
Mkks	T	C	2: 136,877,606		probably null	Het
Mtss1	T	C	15: 58,944,017	M565V	probably damaging	Het
Myoc	A	G	1: 162,649,035	N436S	probably damaging	Het
Myod1	T	A	7: 46,377,112	V147E	probably damaging	Het
Ngef	A	G	1: 87,509,334	L144P	probably benign	Het
Ngrn	C	T	7: 80,261,930	R92W	probably damaging	Het
Nup153	G	A	13: 46,709,654	T349I	probably benign	Het
Olfr1211	T	A	2: 88,930,283	I11L	probably benign	Het
Olfr600	G	T	7: 103,346,204	S241R	possibly damaging	Het
Pigl	A	G	11: 62,503,748	I135M	probably damaging	Het
Pitpnm3	A	G	11: 72,070,492		probably benign	Het
Pkhd1	A	T	1: 20,358,917	F2420I	probably damaging	Het
Polr2b	C	T	5: 77,320,076	T119M	probably damaging	Het
Prr29	A	G	11: 106,376,896	Y130C	probably damaging	Het
Rab11fip3	T	C	17: 25,990,999	I1048V	probably damaging	Het
Rab12	G	A	17: 66,500,362	T124I	probably damaging	Het
Rab44	A	G	17: 29,140,307	S490G	probably benign	Het
Rasa3	A	G	8: 13,570,233		probably null	Het
Rhbdl3	C	T	11: 80,353,574	S369L	possibly damaging	Het
Rimbp2	A	T	5: 128,788,356	S643T	probably benign	Het
Rin1	T	G	19: 5,052,652	S396R	probably damaging	Het
Rpusd3	C	T	6: 113,419,237	G28S	probably damaging	Het
Rtl9	T	A	X: 143,100,278	S229T	probably damaging	Het
Rufy1	G	T	11: 50,389,852	T701N	probably benign	Het
Scn4a	A	T	11: 106,320,538	L1551*	probably null	Het
Sec24b	T	C	3: 129,988,984	N1119S	probably null	Het
Serbp1	T	A	6: 67,272,884	*75R	probably null	Het
Setx	C	T	2: 29,179,673	P2497S	probably benign	Het
Slc26a11	A	T	11: 119,359,314	I132F	probably damaging	Het
Slc4a1	A	G	11: 102,352,684	V707A	possibly damaging	Het
Slfn1	A	G	11: 83,121,843	I262V	probably damaging	Het
Tmem168	T	A	6: 13,583,313	D523V	possibly damaging	Het
Traf7	G	T	17: 24,510,551	Q469K	probably benign	Het
Trdmt1	C	A	2: 13,544,617	V6F	probably damaging	Het
Tsacc	A	T	3: 88,287,088		probably benign	Het
Vmn2r5	A	G	3: 64,491,530	I589T	possibly damaging	Het
Vmn2r7	T	C	3: 64,691,039	D699G	probably damaging	Het
Vmn2r82	T	C	10: 79,381,295	V487A	probably damaging	Het
Zfp287	A	T	11: 62,715,029	S351T	probably benign	Het
Zfp651	T	C	9: 121,767,666	V696A	probably damaging	Het
Zfp654	T	C	16: 64,785,688	H176R	possibly damaging	Het

Other mutations in Cadps2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Cadps2	APN	6	23496874	missense	possibly damaging	0.84
IGL01105:Cadps2	APN	6	23321700	splice site	probably benign
IGL01317:Cadps2	APN	6	23314173	missense	possibly damaging	0.76
IGL01409:Cadps2	APN	6	23587441	missense	probably damaging	1.00
IGL01477:Cadps2	APN	6	23263673	missense	probably damaging	1.00
IGL01620:Cadps2	APN	6	23587462	missense	probably benign	0.19
IGL01674:Cadps2	APN	6	23355852	missense	probably damaging	1.00
IGL01675:Cadps2	APN	6	23382905	missense	probably damaging	1.00
IGL01895:Cadps2	APN	6	23427275	missense	probably damaging	0.98
IGL02095:Cadps2	APN	6	23427310	missense	probably benign	0.01
IGL02200:Cadps2	APN	6	23385528	missense	probably damaging	1.00
IGL02380:Cadps2	APN	6	23287732	missense	probably benign	0.11
IGL02680:Cadps2	APN	6	23838896	missense	probably damaging	0.99
IGL02814:Cadps2	APN	6	23321707	missense	probably damaging	1.00
IGL02940:Cadps2	APN	6	23496809	missense	probably benign	0.08
IGL03061:Cadps2	APN	6	23287660	splice site	probably null
IGL03233:Cadps2	APN	6	23263601	missense	probably benign	0.10
R0389:Cadps2	UTSW	6	23321782	missense	possibly damaging	0.88
R0571:Cadps2	UTSW	6	23583412	missense	probably damaging	1.00
R0595:Cadps2	UTSW	6	23321704	critical splice donor site	probably null
R0620:Cadps2	UTSW	6	23583396	missense	probably damaging	1.00
R0723:Cadps2	UTSW	6	23287698	missense	probably damaging	0.99
R0831:Cadps2	UTSW	6	23321740	missense	possibly damaging	0.88
R0836:Cadps2	UTSW	6	23328776	splice site	probably benign
R0942:Cadps2	UTSW	6	23263562	missense	probably damaging	1.00
R1099:Cadps2	UTSW	6	23599479	missense	probably damaging	1.00
R1120:Cadps2	UTSW	6	23838794	missense	probably damaging	1.00
R1216:Cadps2	UTSW	6	23583473	splice site	probably benign
R1575:Cadps2	UTSW	6	23429218	missense	probably damaging	1.00
R1780:Cadps2	UTSW	6	23320932	critical splice donor site	probably null
R1924:Cadps2	UTSW	6	23688858	missense	probably damaging	0.99
R1944:Cadps2	UTSW	6	23599480	missense	probably damaging	0.99
R1956:Cadps2	UTSW	6	23287686	missense	probably damaging	1.00
R1986:Cadps2	UTSW	6	23323380	missense	probably damaging	1.00
R2045:Cadps2	UTSW	6	23839122	missense	possibly damaging	0.73
R2146:Cadps2	UTSW	6	23838999	intron	probably benign
R2147:Cadps2	UTSW	6	23838999	intron	probably benign
R2148:Cadps2	UTSW	6	23838999	intron	probably benign
R2150:Cadps2	UTSW	6	23838999	intron	probably benign
R2219:Cadps2	UTSW	6	23410832	missense	probably damaging	1.00
R2264:Cadps2	UTSW	6	23323340	missense	probably benign	0.15
R2338:Cadps2	UTSW	6	23838978	splice site	probably benign
R3861:Cadps2	UTSW	6	23355861	missense	probably damaging	1.00
R3898:Cadps2	UTSW	6	23528126	missense	probably damaging	1.00
R3982:Cadps2	UTSW	6	23263531	utr 3 prime	probably benign
R4213:Cadps2	UTSW	6	23599463	missense	probably damaging	1.00
R4384:Cadps2	UTSW	6	23412988	missense	probably benign	0.18
R4432:Cadps2	UTSW	6	23626738	missense	probably damaging	0.99
R4609:Cadps2	UTSW	6	23587579	missense	probably damaging	1.00
R4806:Cadps2	UTSW	6	23688860	missense	probably damaging	0.96
R4977:Cadps2	UTSW	6	23599479	missense	probably damaging	1.00
R5174:Cadps2	UTSW	6	23287743	missense	probably damaging	1.00
R5267:Cadps2	UTSW	6	23626668	missense	possibly damaging	0.79
R5389:Cadps2	UTSW	6	23329104	missense	probably damaging	1.00
R5737:Cadps2	UTSW	6	23328805	missense	probably benign	0.28
R6074:Cadps2	UTSW	6	23626671	missense	probably damaging	1.00
R6254:Cadps2	UTSW	6	23329163	critical splice acceptor site	probably null
R6323:Cadps2	UTSW	6	23263578	missense	probably benign	0.04
R6463:Cadps2	UTSW	6	23323334	nonsense	probably null
R6907:Cadps2	UTSW	6	23599506	missense	probably damaging	1.00
R6940:Cadps2	UTSW	6	23302492	missense	probably damaging	1.00
R6964:Cadps2	UTSW	6	23583459	missense	probably damaging	1.00
R7079:Cadps2	UTSW	6	23323409	missense	probably damaging	1.00
R7139:Cadps2	UTSW	6	23410889	missense	probably damaging	1.00
R7156:Cadps2	UTSW	6	23688956	missense	probably benign	0.02
R7184:Cadps2	UTSW	6	23583429	missense	probably benign	0.18
R7325:Cadps2	UTSW	6	23409935	missense	unknown
R7526:Cadps2	UTSW	6	23496851	missense	probably damaging	1.00
R7546:Cadps2	UTSW	6	23626608	missense	probably benign	0.15
R7772:Cadps2	UTSW	6	23390446	missense	probably benign	0.00
R7870:Cadps2	UTSW	6	23263642	missense	probably benign	0.14
R8040:Cadps2	UTSW	6	23412943	splice site	probably benign
R8048:Cadps2	UTSW	6	23838863	missense	probably benign	0.14
R8082:Cadps2	UTSW	6	23323314	missense	probably damaging	1.00
R8100:Cadps2	UTSW	6	23838809	missense	probably damaging	1.00
R8115:Cadps2	UTSW	6	23328898	missense	probably benign	0.00
R8497:Cadps2	UTSW	6	23355919	missense	probably benign	0.27
R8768:Cadps2	UTSW	6	23382939	missense	probably damaging	1.00
R8783:Cadps2	UTSW	6	23302304	missense	possibly damaging	0.57
R8804:Cadps2	UTSW	6	23496806	missense	probably damaging	1.00
R8832:Cadps2	UTSW	6	23587537	missense	possibly damaging	0.52
R8848:Cadps2	UTSW	6	23344257	missense	probably damaging	1.00
R8854:Cadps2	UTSW	6	23385508	missense	probably damaging	1.00
R8896:Cadps2	UTSW	6	23410877	missense	probably damaging	1.00
R8910:Cadps2	UTSW	6	23344224	missense	probably benign	0.11
R8921:Cadps2	UTSW	6	23302301	missense	probably benign	0.00
R9228:Cadps2	UTSW	6	23688928	missense	probably benign	0.00
R9297:Cadps2	UTSW	6	23496888	missense	probably benign
R9318:Cadps2	UTSW	6	23496888	missense	probably benign
R9348:Cadps2	UTSW	6	23344263	missense	probably benign	0.20
R9447:Cadps2	UTSW	6	23323298	missense	probably damaging	0.96
R9484:Cadps2	UTSW	6	23626647	missense	probably benign	0.02
R9492:Cadps2	UTSW	6	23427239	missense	probably benign
R9630:Cadps2	UTSW	6	23587572	missense	probably benign	0.08
R9729:Cadps2	UTSW	6	23382983	missense	probably benign	0.28
Z1176:Cadps2	UTSW	6	23321801	missense	probably benign	0.24
Z1177:Cadps2	UTSW	6	23385478	missense	possibly damaging	0.88
Z1177:Cadps2	UTSW	6	23626695	missense	probably damaging	1.00
Z1177:Cadps2	UTSW	6	23838818	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGATGGCTAAGACACATCCAGGC -3'
(R):5'- TGGGGTATAGCAGAATCCAGCAGAC -3'

Sequencing Primer
(F):5'- AGGAAAGTCTTCTCCATGACTG -3'
(R):5'- AGACTTCCGAACCGTCTTTAATC -3'

Posted On

2013-04-16