Incidental Mutation 'R2108:Mpp4'
ID232220
Institutional Source Beutler Lab
Gene Symbol Mpp4
Ensembl Gene ENSMUSG00000079550
Gene Namemembrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)
SynonymsDLG6
MMRRC Submission 040112-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2108 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location59120935-59163389 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 59143782 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 322 (P322L)
Ref Sequence ENSEMBL: ENSMUSP00000070711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066374] [ENSMUST00000078874] [ENSMUST00000114275] [ENSMUST00000186477] [ENSMUST00000191200]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066374
AA Change: P322L

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000070711
Gene: ENSMUSG00000079550
AA Change: P322L

DomainStartEndE-ValueType
L27 27 82 4.02e-9 SMART
L27 86 139 2.49e-14 SMART
PDZ 161 234 3.57e-11 SMART
SH3 244 310 2.94e-5 SMART
low complexity region 397 406 N/A INTRINSIC
GuKc 425 618 1.21e-50 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000078874
AA Change: P322L

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000077914
Gene: ENSMUSG00000079550
AA Change: P322L

DomainStartEndE-ValueType
L27 27 82 4.02e-9 SMART
L27 86 139 2.49e-14 SMART
PDZ 161 234 3.57e-11 SMART
SH3 244 310 2.94e-5 SMART
low complexity region 348 362 N/A INTRINSIC
low complexity region 397 406 N/A INTRINSIC
GuKc 425 618 1.21e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114275
AA Change: P341L

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109914
Gene: ENSMUSG00000079550
AA Change: P341L

DomainStartEndE-ValueType
L27 46 101 4.02e-9 SMART
L27 105 158 2.49e-14 SMART
PDZ 180 253 3.57e-11 SMART
SH3 263 329 2.94e-5 SMART
low complexity region 367 381 N/A INTRINSIC
low complexity region 416 425 N/A INTRINSIC
GuKc 444 637 1.21e-50 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000186477
AA Change: P309L

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140352
Gene: ENSMUSG00000079550
AA Change: P309L

DomainStartEndE-ValueType
L27 27 82 1.3e-11 SMART
L27 86 139 8.6e-17 SMART
PDZ 161 234 1.8e-13 SMART
SH3 222 297 5.1e-4 SMART
low complexity region 353 362 N/A INTRINSIC
GuKc 381 574 5.8e-53 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187825
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188494
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189884
Predicted Effect possibly damaging
Transcript: ENSMUST00000191200
AA Change: P322L

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140957
Gene: ENSMUSG00000079550
AA Change: P322L

DomainStartEndE-ValueType
L27 27 82 4.02e-9 SMART
L27 86 139 2.49e-14 SMART
PDZ 161 234 3.57e-11 SMART
SH3 244 310 2.94e-5 SMART
low complexity region 342 356 N/A INTRINSIC
low complexity region 391 400 N/A INTRINSIC
GuKc 419 612 1.21e-50 SMART
Meta Mutation Damage Score 0.2408 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-associated guanylate kinase (MAGUK) protein family, with an N-terminal PDZ domain, a central src homology 3 region (SH3), and a C-terminal guanylate kinase-like (GUK) domain. The protein is localized to the outer limiting membrane in the retina, and is thought to function in photoreceptor polarity and the organization of specialized intercellular junctions. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for mutations display sporadic photorecptor displacement. Correct protein localization at the presynaptic photoreceptor membrane. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd10 A G 16: 45,731,940 M190T probably benign Het
Abhd5 A G 9: 122,377,940 Y250C probably damaging Het
Ace2 A G X: 164,140,732 N24S probably benign Het
Adamtsl2 A G 2: 27,095,558 M485V probably benign Het
Adamtsl4 G T 3: 95,681,047 P577H probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Apc T C 18: 34,269,229 Y141H probably damaging Het
Arsi A T 18: 60,916,371 T109S possibly damaging Het
Asb3 G A 11: 31,081,355 probably null Het
Atm T C 9: 53,443,997 D2899G probably damaging Het
Bcas3 G A 11: 85,457,878 V199I probably damaging Het
Bub1 T C 2: 127,819,335 K279E probably damaging Het
C3 A T 17: 57,223,974 probably null Het
Cabcoco1 T C 10: 68,431,323 K185E probably benign Het
Cadm2 A T 16: 66,731,471 I326N probably benign Het
Ccr3 T C 9: 124,029,299 S224P possibly damaging Het
Cdhr4 A G 9: 107,997,644 T638A probably damaging Het
Cfap46 T C 7: 139,683,761 I4V probably benign Het
Csf2rb2 A T 15: 78,292,544 V216E probably damaging Het
Csmd3 A T 15: 48,004,861 D754E possibly damaging Het
Dnaaf1 T C 8: 119,582,732 probably null Het
Dnah11 A C 12: 118,020,353 Y2466D probably damaging Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
E2f7 T C 10: 110,780,902 Y668H probably benign Het
Ehmt1 A T 2: 24,837,618 S735T probably damaging Het
Eomes T C 9: 118,478,852 F65L probably benign Het
Ercc6l2 T C 13: 63,871,988 probably benign Het
Fbrsl1 A T 5: 110,378,434 L439Q probably damaging Het
Fyco1 C T 9: 123,797,516 probably null Het
Gfm2 A G 13: 97,155,442 T229A probably benign Het
Gm7735 G A 16: 89,169,545 G19D unknown Het
Gm9745 G A 13: 8,941,728 P221S possibly damaging Het
Gnpda1 T C 18: 38,333,190 probably null Het
Gpr6 T A 10: 41,070,653 Y311F possibly damaging Het
Gprc6a A T 10: 51,615,208 V744E probably damaging Het
Grin3a C T 4: 49,665,510 D1042N possibly damaging Het
Gstm3 A G 3: 107,966,134 C174R probably damaging Het
Hectd4 A G 5: 121,333,424 E2670G possibly damaging Het
Hsd3b6 A T 3: 98,806,187 Y265* probably null Het
Hus1 T A 11: 9,011,110 M1L probably null Het
Ifi213 T G 1: 173,569,102 probably null Het
Igf2r A C 17: 12,698,251 N1587K probably benign Het
Ints1 A T 5: 139,767,750 V709E probably damaging Het
Ints8 C A 4: 11,235,552 R359L probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrp1b C T 2: 41,110,757 E2152K probably damaging Het
Lrp2 A T 2: 69,506,624 V1268D possibly damaging Het
Mpo T C 11: 87,796,075 Y177H probably damaging Het
Mprip A G 11: 59,769,891 K2166R probably damaging Het
Myo15 T C 11: 60,491,810 Y1544H probably damaging Het
Neu1 G A 17: 34,934,398 R299Q probably benign Het
Nfxl1 C A 5: 72,514,332 probably null Het
Nrp2 T A 1: 62,744,277 I179N probably damaging Het
Nup153 A G 13: 46,693,510 probably null Het
Olfr130 G T 17: 38,067,855 R228L possibly damaging Het
Olfr350 C A 2: 36,850,343 A99E possibly damaging Het
Olfr474 A T 7: 107,955,502 H287L probably benign Het
Olfr804 A T 10: 129,705,621 I248L probably benign Het
Olfr944 A T 9: 39,218,022 I222F probably damaging Het
P2ry12 A T 3: 59,217,353 D300E probably damaging Het
Pkhd1 C A 1: 20,553,574 G766* probably null Het
Plagl1 A C 10: 13,128,647 probably benign Het
Prkcq A T 2: 11,232,569 Y53F probably damaging Het
Psg18 T C 7: 18,350,874 E99G probably damaging Het
Ptprz1 T A 6: 23,033,477 H1921Q probably damaging Het
Rcc1l A G 5: 134,155,790 V391A probably benign Het
Sdr42e1 C T 8: 117,665,024 V11I probably damaging Het
Slc12a3 C A 8: 94,340,530 N404K probably damaging Het
Slc38a4 T C 15: 97,008,997 M287V probably benign Het
Slc6a8 A T X: 73,676,886 I96F possibly damaging Het
Smyd2 A G 1: 189,897,426 S136P probably damaging Het
Sox11 A G 12: 27,341,703 Y236H probably damaging Het
Tbc1d2 G A 4: 46,637,652 P198L possibly damaging Het
Tcof1 G T 18: 60,835,773 A256E probably damaging Het
Tenm4 A G 7: 96,906,290 Y2726C probably damaging Het
Tnfsf14 T A 17: 57,190,867 R122W probably damaging Het
Tril T C 6: 53,819,083 T385A probably damaging Het
Trrap A G 5: 144,825,874 T2386A probably benign Het
Tspear T A 10: 77,870,419 L341H possibly damaging Het
Uba7 A G 9: 107,979,288 M595V probably benign Het
Usp43 GC G 11: 67,855,740 probably null Het
Utrn C A 10: 12,436,364 D616Y probably damaging Het
Vmn2r69 T C 7: 85,410,196 I502V probably benign Het
Vps13d C A 4: 145,075,047 G419C probably damaging Het
Zbtb25 A T 12: 76,350,106 M114K probably benign Het
Zcchc4 A G 5: 52,796,132 Y161C probably damaging Het
Zfp292 A T 4: 34,808,593 F1484I possibly damaging Het
Zfp326 A G 5: 105,914,780 probably benign Het
Zfp395 T A 14: 65,393,116 S372T probably benign Het
Zfp423 T A 8: 87,781,178 E825V possibly damaging Het
Zfp445 A T 9: 122,852,240 Y879N probably benign Het
Zfp451 A G 1: 33,779,167 I77T possibly damaging Het
Zfp85 A T 13: 67,748,884 S356R probably benign Het
Other mutations in Mpp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Mpp4 APN 1 59149519 critical splice donor site probably null
IGL01346:Mpp4 APN 1 59125560 missense probably damaging 1.00
IGL01680:Mpp4 APN 1 59130067 missense probably benign 0.21
IGL02123:Mpp4 APN 1 59161466 splice site probably null
IGL02299:Mpp4 APN 1 59158579 splice site probably benign
IGL02793:Mpp4 APN 1 59136834 splice site probably null
IGL02875:Mpp4 APN 1 59136834 splice site probably null
E0370:Mpp4 UTSW 1 59139758 splice site probably benign
R0391:Mpp4 UTSW 1 59143829 splice site probably benign
R0517:Mpp4 UTSW 1 59124727 nonsense probably null
R0725:Mpp4 UTSW 1 59121422 missense probably damaging 1.00
R0968:Mpp4 UTSW 1 59130090 missense probably damaging 1.00
R1753:Mpp4 UTSW 1 59144810 missense probably null 1.00
R1956:Mpp4 UTSW 1 59158652 missense probably benign 0.01
R1968:Mpp4 UTSW 1 59144802 missense probably damaging 1.00
R2062:Mpp4 UTSW 1 59143782 missense possibly damaging 0.92
R2064:Mpp4 UTSW 1 59143782 missense possibly damaging 0.92
R2065:Mpp4 UTSW 1 59143782 missense possibly damaging 0.92
R2068:Mpp4 UTSW 1 59143782 missense possibly damaging 0.92
R2088:Mpp4 UTSW 1 59123465 missense possibly damaging 0.68
R2426:Mpp4 UTSW 1 59130057 missense probably damaging 0.99
R2897:Mpp4 UTSW 1 59144694 missense probably benign
R2898:Mpp4 UTSW 1 59144694 missense probably benign
R3908:Mpp4 UTSW 1 59149037 missense probably damaging 0.99
R3938:Mpp4 UTSW 1 59124683 missense possibly damaging 0.94
R4050:Mpp4 UTSW 1 59146744 splice site probably null
R4396:Mpp4 UTSW 1 59144802 missense possibly damaging 0.56
R4908:Mpp4 UTSW 1 59125589 missense probably damaging 1.00
R5169:Mpp4 UTSW 1 59130097 critical splice acceptor site probably null
R5185:Mpp4 UTSW 1 59125583 missense probably benign 0.10
R5249:Mpp4 UTSW 1 59144858 splice site probably benign
R5333:Mpp4 UTSW 1 59157441 missense probably benign 0.03
R5563:Mpp4 UTSW 1 59124629 critical splice donor site probably null
R5779:Mpp4 UTSW 1 59151666 missense probably benign 0.09
R5829:Mpp4 UTSW 1 59128942 missense probably damaging 0.99
R5934:Mpp4 UTSW 1 59121376 missense probably damaging 1.00
R6017:Mpp4 UTSW 1 59121359 missense probably damaging 1.00
R6845:Mpp4 UTSW 1 59144804 missense probably benign 0.05
R7013:Mpp4 UTSW 1 59149615 missense probably damaging 1.00
R7292:Mpp4 UTSW 1 59143810 missense possibly damaging 0.51
R7775:Mpp4 UTSW 1 59123513 missense not run
R7778:Mpp4 UTSW 1 59123513 missense not run
R7912:Mpp4 UTSW 1 59121362 missense probably damaging 1.00
R7993:Mpp4 UTSW 1 59121362 missense probably damaging 1.00
X0013:Mpp4 UTSW 1 59123453 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- ACCCACGGACATGTTTAACTTC -3'
(R):5'- TGGTGTGCTGGAGCCAAATG -3'

Sequencing Primer
(F):5'- CCTCCATCAGATTGGCATGATTGAG -3'
(R):5'- TGCTGGAGCCAAATGACAAAGTC -3'
Posted On2014-09-18