Incidental Mutation 'R2108:Ptprz1'
ID232252
Institutional Source Beutler Lab
Gene Symbol Ptprz1
Ensembl Gene ENSMUSG00000068748
Gene Nameprotein tyrosine phosphatase, receptor type Z, polypeptide 1
SynonymsPTPzeta, RPTPz, phosphacan, Rptpbeta, DSD-1-PG, PTPbeta, Ptprz, Ptpz
MMRRC Submission 040112-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.698) question?
Stock #R2108 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location22875502-23052916 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23033477 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 1921 (H1921Q)
Ref Sequence ENSEMBL: ENSMUSP00000088056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090568] [ENSMUST00000202102]
Predicted Effect probably damaging
Transcript: ENSMUST00000090568
AA Change: H1921Q

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000088056
Gene: ENSMUSG00000068748
AA Change: H1921Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Carb_anhydrase 38 300 5.12e-99 SMART
FN3 312 397 5.53e-4 SMART
low complexity region 588 609 N/A INTRINSIC
low complexity region 825 837 N/A INTRINSIC
low complexity region 1417 1441 N/A INTRINSIC
low complexity region 1485 1495 N/A INTRINSIC
Blast:PTPc 1497 1573 1e-12 BLAST
low complexity region 1606 1620 N/A INTRINSIC
transmembrane domain 1637 1659 N/A INTRINSIC
low complexity region 1679 1693 N/A INTRINSIC
PTPc 1720 1991 2.8e-130 SMART
PTPc 2019 2281 1.65e-77 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000202102
AA Change: H1072Q

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143902
Gene: ENSMUSG00000068748
AA Change: H1072Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Carb_anhydrase 38 300 5.12e-99 SMART
FN3 312 397 5.53e-4 SMART
low complexity region 588 609 N/A INTRINSIC
transmembrane domain 788 810 N/A INTRINSIC
low complexity region 830 844 N/A INTRINSIC
PTPc 871 1142 2.8e-130 SMART
PTPc 1170 1432 1.65e-77 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor protein tyrosine phosphatase family. Expression of this gene is restricted to the central nervous system (CNS), and it may be involved in the regulation of specific developmental processes in the CNS. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for targeted null mutations demonstrate an impaired ability to recover from inflamatory lesions of the CNS or gastric mucosa. Mice homozygous for a knock-out allele exhibit increased tactile and thermal nociception thresholds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd10 A G 16: 45,731,940 M190T probably benign Het
Abhd5 A G 9: 122,377,940 Y250C probably damaging Het
Ace2 A G X: 164,140,732 N24S probably benign Het
Adamtsl2 A G 2: 27,095,558 M485V probably benign Het
Adamtsl4 G T 3: 95,681,047 P577H probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Apc T C 18: 34,269,229 Y141H probably damaging Het
Arsi A T 18: 60,916,371 T109S possibly damaging Het
Asb3 G A 11: 31,081,355 probably null Het
Atm T C 9: 53,443,997 D2899G probably damaging Het
Bcas3 G A 11: 85,457,878 V199I probably damaging Het
Bub1 T C 2: 127,819,335 K279E probably damaging Het
C3 A T 17: 57,223,974 probably null Het
Cabcoco1 T C 10: 68,431,323 K185E probably benign Het
Cadm2 A T 16: 66,731,471 I326N probably benign Het
Ccr3 T C 9: 124,029,299 S224P possibly damaging Het
Cdhr4 A G 9: 107,997,644 T638A probably damaging Het
Cfap46 T C 7: 139,683,761 I4V probably benign Het
Csf2rb2 A T 15: 78,292,544 V216E probably damaging Het
Csmd3 A T 15: 48,004,861 D754E possibly damaging Het
Dnaaf1 T C 8: 119,582,732 probably null Het
Dnah11 A C 12: 118,020,353 Y2466D probably damaging Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
E2f7 T C 10: 110,780,902 Y668H probably benign Het
Ehmt1 A T 2: 24,837,618 S735T probably damaging Het
Eomes T C 9: 118,478,852 F65L probably benign Het
Ercc6l2 T C 13: 63,871,988 probably benign Het
Fbrsl1 A T 5: 110,378,434 L439Q probably damaging Het
Fyco1 C T 9: 123,797,516 probably null Het
Gfm2 A G 13: 97,155,442 T229A probably benign Het
Gm7735 G A 16: 89,169,545 G19D unknown Het
Gm9745 G A 13: 8,941,728 P221S possibly damaging Het
Gnpda1 T C 18: 38,333,190 probably null Het
Gpr6 T A 10: 41,070,653 Y311F possibly damaging Het
Gprc6a A T 10: 51,615,208 V744E probably damaging Het
Grin3a C T 4: 49,665,510 D1042N possibly damaging Het
Gstm3 A G 3: 107,966,134 C174R probably damaging Het
Hectd4 A G 5: 121,333,424 E2670G possibly damaging Het
Hsd3b6 A T 3: 98,806,187 Y265* probably null Het
Hus1 T A 11: 9,011,110 M1L probably null Het
Ifi213 T G 1: 173,569,102 probably null Het
Igf2r A C 17: 12,698,251 N1587K probably benign Het
Ints1 A T 5: 139,767,750 V709E probably damaging Het
Ints8 C A 4: 11,235,552 R359L probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrp1b C T 2: 41,110,757 E2152K probably damaging Het
Lrp2 A T 2: 69,506,624 V1268D possibly damaging Het
Mpo T C 11: 87,796,075 Y177H probably damaging Het
Mpp4 G A 1: 59,143,782 P322L possibly damaging Het
Mprip A G 11: 59,769,891 K2166R probably damaging Het
Myo15 T C 11: 60,491,810 Y1544H probably damaging Het
Neu1 G A 17: 34,934,398 R299Q probably benign Het
Nfxl1 C A 5: 72,514,332 probably null Het
Nrp2 T A 1: 62,744,277 I179N probably damaging Het
Nup153 A G 13: 46,693,510 probably null Het
Olfr130 G T 17: 38,067,855 R228L possibly damaging Het
Olfr350 C A 2: 36,850,343 A99E possibly damaging Het
Olfr474 A T 7: 107,955,502 H287L probably benign Het
Olfr804 A T 10: 129,705,621 I248L probably benign Het
Olfr944 A T 9: 39,218,022 I222F probably damaging Het
P2ry12 A T 3: 59,217,353 D300E probably damaging Het
Pkhd1 C A 1: 20,553,574 G766* probably null Het
Plagl1 A C 10: 13,128,647 probably benign Het
Prkcq A T 2: 11,232,569 Y53F probably damaging Het
Psg18 T C 7: 18,350,874 E99G probably damaging Het
Rcc1l A G 5: 134,155,790 V391A probably benign Het
Sdr42e1 C T 8: 117,665,024 V11I probably damaging Het
Slc12a3 C A 8: 94,340,530 N404K probably damaging Het
Slc38a4 T C 15: 97,008,997 M287V probably benign Het
Slc6a8 A T X: 73,676,886 I96F possibly damaging Het
Smyd2 A G 1: 189,897,426 S136P probably damaging Het
Sox11 A G 12: 27,341,703 Y236H probably damaging Het
Tbc1d2 G A 4: 46,637,652 P198L possibly damaging Het
Tcof1 G T 18: 60,835,773 A256E probably damaging Het
Tenm4 A G 7: 96,906,290 Y2726C probably damaging Het
Tnfsf14 T A 17: 57,190,867 R122W probably damaging Het
Tril T C 6: 53,819,083 T385A probably damaging Het
Trrap A G 5: 144,825,874 T2386A probably benign Het
Tspear T A 10: 77,870,419 L341H possibly damaging Het
Uba7 A G 9: 107,979,288 M595V probably benign Het
Usp43 GC G 11: 67,855,740 probably null Het
Utrn C A 10: 12,436,364 D616Y probably damaging Het
Vmn2r69 T C 7: 85,410,196 I502V probably benign Het
Vps13d C A 4: 145,075,047 G419C probably damaging Het
Zbtb25 A T 12: 76,350,106 M114K probably benign Het
Zcchc4 A G 5: 52,796,132 Y161C probably damaging Het
Zfp292 A T 4: 34,808,593 F1484I possibly damaging Het
Zfp326 A G 5: 105,914,780 probably benign Het
Zfp395 T A 14: 65,393,116 S372T probably benign Het
Zfp423 T A 8: 87,781,178 E825V possibly damaging Het
Zfp445 A T 9: 122,852,240 Y879N probably benign Het
Zfp451 A G 1: 33,779,167 I77T possibly damaging Het
Zfp85 A T 13: 67,748,884 S356R probably benign Het
Other mutations in Ptprz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Ptprz1 APN 6 22973054 missense probably damaging 1.00
IGL00773:Ptprz1 APN 6 23002629 missense probably benign 0.41
IGL01458:Ptprz1 APN 6 22972844 missense probably damaging 0.99
IGL01481:Ptprz1 APN 6 22999980 missense probably benign 0.05
IGL01501:Ptprz1 APN 6 22973082 missense probably damaging 1.00
IGL01601:Ptprz1 APN 6 23000438 missense probably damaging 0.99
IGL01882:Ptprz1 APN 6 23000464 missense probably damaging 1.00
IGL02058:Ptprz1 APN 6 23002503 missense probably benign 0.00
IGL02089:Ptprz1 APN 6 23033448 missense probably damaging 1.00
IGL02136:Ptprz1 APN 6 22972822 missense probably damaging 1.00
IGL02215:Ptprz1 APN 6 22965182 missense possibly damaging 0.91
IGL02220:Ptprz1 APN 6 23042743 splice site probably benign
IGL02556:Ptprz1 APN 6 22972845 missense probably benign 0.01
IGL02601:Ptprz1 APN 6 23000687 missense probably benign 0.11
IGL02620:Ptprz1 APN 6 22959740 missense probably damaging 1.00
IGL02666:Ptprz1 APN 6 23001210 missense probably benign 0.00
IGL02718:Ptprz1 APN 6 23001349 missense possibly damaging 0.77
IGL02792:Ptprz1 APN 6 22959723 missense probably damaging 1.00
IGL02894:Ptprz1 APN 6 23035149 missense probably damaging 1.00
IGL02952:Ptprz1 APN 6 23036926 missense probably damaging 1.00
IGL03003:Ptprz1 APN 6 23002583 missense probably damaging 0.98
IGL03060:Ptprz1 APN 6 22972835 missense probably damaging 1.00
IGL03170:Ptprz1 APN 6 22959767 missense probably benign 0.00
IGL03246:Ptprz1 APN 6 22986160 missense probably damaging 0.99
IGL03349:Ptprz1 APN 6 23000332 missense probably damaging 1.00
IGL03365:Ptprz1 APN 6 23030582 splice site probably benign
R0044:Ptprz1 UTSW 6 23007403 missense probably damaging 1.00
R0054:Ptprz1 UTSW 6 22986196 missense probably damaging 1.00
R0054:Ptprz1 UTSW 6 22986196 missense probably damaging 1.00
R0107:Ptprz1 UTSW 6 23000570 missense probably damaging 0.98
R0278:Ptprz1 UTSW 6 23000817 missense probably benign 0.31
R0345:Ptprz1 UTSW 6 23016165 missense probably damaging 1.00
R0359:Ptprz1 UTSW 6 22973176 splice site probably benign
R0743:Ptprz1 UTSW 6 23044367 nonsense probably null
R1014:Ptprz1 UTSW 6 23000644 missense probably damaging 1.00
R1016:Ptprz1 UTSW 6 23000974 missense probably damaging 1.00
R1106:Ptprz1 UTSW 6 22965749 missense probably damaging 0.99
R1391:Ptprz1 UTSW 6 23001729 missense probably benign 0.33
R1424:Ptprz1 UTSW 6 23000383 missense probably benign 0.00
R1445:Ptprz1 UTSW 6 23050474 missense probably damaging 1.00
R1496:Ptprz1 UTSW 6 23049524 splice site probably benign
R1544:Ptprz1 UTSW 6 23000748 missense possibly damaging 0.63
R1626:Ptprz1 UTSW 6 23001574 missense probably benign
R1641:Ptprz1 UTSW 6 23049606 missense probably damaging 1.00
R1757:Ptprz1 UTSW 6 23044320 missense probably damaging 1.00
R1812:Ptprz1 UTSW 6 22959712 missense probably benign 0.07
R1917:Ptprz1 UTSW 6 23035040 splice site probably benign
R1930:Ptprz1 UTSW 6 23007355 missense probably damaging 1.00
R1931:Ptprz1 UTSW 6 23007355 missense probably damaging 1.00
R1974:Ptprz1 UTSW 6 22986311 missense probably damaging 1.00
R1992:Ptprz1 UTSW 6 22959748 missense probably benign 0.24
R1997:Ptprz1 UTSW 6 23050497 missense probably damaging 0.99
R2002:Ptprz1 UTSW 6 23027834 nonsense probably null
R2012:Ptprz1 UTSW 6 23001027 missense probably benign 0.03
R2059:Ptprz1 UTSW 6 22986323 splice site probably benign
R2061:Ptprz1 UTSW 6 23049675 critical splice donor site probably null
R2064:Ptprz1 UTSW 6 23050389 splice site probably benign
R2067:Ptprz1 UTSW 6 23050389 splice site probably benign
R2152:Ptprz1 UTSW 6 23030671 missense probably damaging 0.99
R2166:Ptprz1 UTSW 6 23045633 missense possibly damaging 0.90
R2183:Ptprz1 UTSW 6 23002285 missense probably benign
R2202:Ptprz1 UTSW 6 23000650 missense possibly damaging 0.63
R2238:Ptprz1 UTSW 6 22987377 missense probably damaging 1.00
R2290:Ptprz1 UTSW 6 23000991 missense probably damaging 1.00
R3027:Ptprz1 UTSW 6 23016197 missense possibly damaging 0.89
R3861:Ptprz1 UTSW 6 23036895 missense probably damaging 0.98
R4012:Ptprz1 UTSW 6 23002585 missense probably damaging 0.99
R4020:Ptprz1 UTSW 6 22959624 splice site probably benign
R4158:Ptprz1 UTSW 6 23001684 nonsense probably null
R4158:Ptprz1 UTSW 6 23022205 missense possibly damaging 0.73
R4159:Ptprz1 UTSW 6 23001684 nonsense probably null
R4160:Ptprz1 UTSW 6 23022205 missense possibly damaging 0.73
R4606:Ptprz1 UTSW 6 23001487 missense possibly damaging 0.80
R4621:Ptprz1 UTSW 6 23001454 missense possibly damaging 0.68
R4640:Ptprz1 UTSW 6 22972798 missense probably damaging 1.00
R4731:Ptprz1 UTSW 6 23002610 missense probably benign 0.06
R4732:Ptprz1 UTSW 6 23002610 missense probably benign 0.06
R4733:Ptprz1 UTSW 6 23002610 missense probably benign 0.06
R4803:Ptprz1 UTSW 6 23001546 missense probably benign 0.00
R4890:Ptprz1 UTSW 6 23024958 missense probably damaging 1.00
R5035:Ptprz1 UTSW 6 23016215 missense probably benign 0.06
R5052:Ptprz1 UTSW 6 23045626 missense probably damaging 1.00
R5106:Ptprz1 UTSW 6 23000028 missense probably benign 0.04
R5248:Ptprz1 UTSW 6 23001901 missense probably benign 0.11
R5292:Ptprz1 UTSW 6 23002582 missense probably benign 0.31
R5373:Ptprz1 UTSW 6 23007355 missense probably damaging 1.00
R5374:Ptprz1 UTSW 6 23007355 missense probably damaging 1.00
R5378:Ptprz1 UTSW 6 23007402 missense probably damaging 1.00
R5408:Ptprz1 UTSW 6 23002600 missense probably damaging 1.00
R5479:Ptprz1 UTSW 6 23001666 missense probably benign
R5524:Ptprz1 UTSW 6 22986318 splice site probably null
R5527:Ptprz1 UTSW 6 23000053 missense possibly damaging 0.66
R5557:Ptprz1 UTSW 6 23001001 missense probably benign 0.04
R5654:Ptprz1 UTSW 6 22986134 missense probably damaging 1.00
R5655:Ptprz1 UTSW 6 22999773 missense probably benign 0.00
R5658:Ptprz1 UTSW 6 23016189 missense probably damaging 1.00
R5663:Ptprz1 UTSW 6 23035143 missense probably damaging 1.00
R5765:Ptprz1 UTSW 6 23000236 missense probably damaging 1.00
R5822:Ptprz1 UTSW 6 23001445 missense probably benign 0.01
R5837:Ptprz1 UTSW 6 23001418 missense probably benign 0.00
R6108:Ptprz1 UTSW 6 23045659 missense probably damaging 1.00
R6199:Ptprz1 UTSW 6 23002471 missense probably benign 0.01
R6245:Ptprz1 UTSW 6 23051990 missense probably damaging 1.00
R6257:Ptprz1 UTSW 6 22959640 missense probably damaging 1.00
R6488:Ptprz1 UTSW 6 23001517 nonsense probably null
R6606:Ptprz1 UTSW 6 23002501 missense probably benign 0.27
R6612:Ptprz1 UTSW 6 23052082 missense probably damaging 1.00
R6824:Ptprz1 UTSW 6 23002131 missense probably benign 0.05
R6834:Ptprz1 UTSW 6 22999633 missense probably benign 0.38
R6836:Ptprz1 UTSW 6 23030665 nonsense probably null
R6991:Ptprz1 UTSW 6 23002687 missense probably benign 0.00
R7044:Ptprz1 UTSW 6 23044346 missense probably damaging 1.00
R7048:Ptprz1 UTSW 6 22961623 missense probably benign 0.18
R7225:Ptprz1 UTSW 6 23000929 missense possibly damaging 0.61
R7284:Ptprz1 UTSW 6 23000098 missense probably damaging 1.00
R7360:Ptprz1 UTSW 6 23000907 missense probably damaging 1.00
R7501:Ptprz1 UTSW 6 23001747 nonsense probably null
R7515:Ptprz1 UTSW 6 23022267 missense probably damaging 1.00
R7538:Ptprz1 UTSW 6 22999896 missense possibly damaging 0.81
R7567:Ptprz1 UTSW 6 22959780 missense probably damaging 0.97
R7599:Ptprz1 UTSW 6 23002519 missense not run
R7611:Ptprz1 UTSW 6 23001220 missense probably benign
R7685:Ptprz1 UTSW 6 23024978 missense probably damaging 1.00
R7707:Ptprz1 UTSW 6 23002296 missense probably benign 0.00
R7733:Ptprz1 UTSW 6 23000384 missense probably benign 0.31
R7786:Ptprz1 UTSW 6 23036993 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAGTGAGAGTCCAAATCATCAAGAC -3'
(R):5'- ATCAATCCTTATGTGGATGGGG -3'

Sequencing Primer
(F):5'- GACAACTGCCTTGCTAAATGGTC -3'
(R):5'- GGATGGGGATATAATTTCACTTCTCC -3'
Posted On2014-09-18