Mutagenetix > Incidental Mutation

Incidental Mutation 'R2108:Tenm4'

232257

Institutional Source

Beutler Lab

Gene Symbol

Tenm4

Ensembl Gene

ENSMUSG00000048078

Gene Name

teneurin transmembrane protein 4

Synonyms

Doc4, l7Rn3, Ten-m4, ELM2, l(7)-3Rn, Odz4

MMRRC Submission

040112-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2108 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

96171246-96911093 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 96906290 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 2726 (Y2726C)

Ref Sequence

ENSEMBL: ENSMUSP00000102780 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107162] [ENSMUST00000107165] [ENSMUST00000107166]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000107162
AA Change: Y2726C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102780
Gene: ENSMUSG00000048078
AA Change: Y2726C

Domain	Start	End	E-Value	Type
Pfam:Ten_N	10	410	5.6e-195	PFAM
transmembrane domain	411	433	N/A	INTRINSIC
EGF_like	637	665	3.43e1	SMART
EGF	668	696	2.29e1	SMART
EGF	701	730	1.88e-1	SMART
EGF	733	762	1.13e1	SMART
EGF	767	797	2.39e1	SMART
EGF	800	828	4.32e-1	SMART
EGF	831	859	6.02e0	SMART
EGF	862	894	9.93e-1	SMART
low complexity region	900	914	N/A	INTRINSIC
Pfam:RHS_repeat	2327	2380	5.5e-7	PFAM
Pfam:Tox-GHH	2740	2818	5.2e-34	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000107165
AA Change: Y2734C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000102783
Gene: ENSMUSG00000048078
AA Change: Y2734C

Domain	Start	End	E-Value	Type
Pfam:Ten_N	36	402	1.1e-171	PFAM
transmembrane domain	403	425	N/A	INTRINSIC
EGF_like	629	657	3.43e1	SMART
EGF	660	688	2.29e1	SMART
EGF	693	722	1.88e-1	SMART
EGF	725	754	1.13e1	SMART
EGF	759	789	2.39e1	SMART
EGF	792	820	4.32e-1	SMART
EGF	823	851	6.02e0	SMART
EGF	863	895	9.93e-1	SMART
low complexity region	901	915	N/A	INTRINSIC
Pfam:RHS_repeat	2335	2368	1.6e-7	PFAM
Pfam:Tox-GHH	2749	2826	1.8e-32	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000107166
AA Change: Y2697C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000102784
Gene: ENSMUSG00000048078
AA Change: Y2697C

Domain	Start	End	E-Value	Type
Pfam:Ten_N	35	193	1.4e-83	PFAM
Pfam:Ten_N	187	365	5e-78	PFAM
transmembrane domain	366	388	N/A	INTRINSIC
EGF_like	592	620	3.43e1	SMART
EGF	623	651	2.29e1	SMART
EGF	656	685	1.88e-1	SMART
EGF	688	717	1.13e1	SMART
EGF	722	752	2.39e1	SMART
EGF	755	783	4.32e-1	SMART
EGF	786	814	6.02e0	SMART
EGF	826	858	9.93e-1	SMART
low complexity region	864	878	N/A	INTRINSIC
Pfam:RHS_repeat	2298	2351	3.8e-7	PFAM
Pfam:Tox-GHH	2711	2789	3.9e-34	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136294

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays a role in establishing proper neuronal connectivity during development. Defects in this gene have been associated with hereditary essential tremor-5. [provided by RefSeq, Oct 2016]
PHENOTYPE: Various ENU-induced alleles cause prenatal lethality associated with impaired mesoderm development and lead to pleiotropic phenotypes. The most severe alleles cause failure of gastrulation and somitogenesis while the least severe one allows survival to adulthood with runting of variable penetrance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd10	A	G	16: 45,731,940	M190T	probably benign	Het
Abhd5	A	G	9: 122,377,940	Y250C	probably damaging	Het
Ace2	A	G	X: 164,140,732	N24S	probably benign	Het
Adamtsl2	A	G	2: 27,095,558	M485V	probably benign	Het
Adamtsl4	G	T	3: 95,681,047	P577H	probably damaging	Het
Akap8l	C	T	17: 32,332,483	R511H	probably damaging	Het
Apc	T	C	18: 34,269,229	Y141H	probably damaging	Het
Arsi	A	T	18: 60,916,371	T109S	possibly damaging	Het
Asb3	G	A	11: 31,081,355		probably null	Het
Atm	T	C	9: 53,443,997	D2899G	probably damaging	Het
Bcas3	G	A	11: 85,457,878	V199I	probably damaging	Het
Bub1	T	C	2: 127,819,335	K279E	probably damaging	Het
C3	A	T	17: 57,223,974		probably null	Het
Cabcoco1	T	C	10: 68,431,323	K185E	probably benign	Het
Cadm2	A	T	16: 66,731,471	I326N	probably benign	Het
Ccr3	T	C	9: 124,029,299	S224P	possibly damaging	Het
Cdhr4	A	G	9: 107,997,644	T638A	probably damaging	Het
Cfap46	T	C	7: 139,683,761	I4V	probably benign	Het
Csf2rb2	A	T	15: 78,292,544	V216E	probably damaging	Het
Csmd3	A	T	15: 48,004,861	D754E	possibly damaging	Het
Dnaaf1	T	C	8: 119,582,732		probably null	Het
Dnah11	A	C	12: 118,020,353	Y2466D	probably damaging	Het
Dtx2	C	T	5: 136,030,577	S493F	probably damaging	Het
E2f7	T	C	10: 110,780,902	Y668H	probably benign	Het
Ehmt1	A	T	2: 24,837,618	S735T	probably damaging	Het
Eomes	T	C	9: 118,478,852	F65L	probably benign	Het
Ercc6l2	T	C	13: 63,871,988		probably benign	Het
Fbrsl1	A	T	5: 110,378,434	L439Q	probably damaging	Het
Fyco1	C	T	9: 123,797,516		probably null	Het
Gfm2	A	G	13: 97,155,442	T229A	probably benign	Het
Gm7735	G	A	16: 89,169,545	G19D	unknown	Het
Gm9745	G	A	13: 8,941,728	P221S	possibly damaging	Het
Gnpda1	T	C	18: 38,333,190		probably null	Het
Gpr6	T	A	10: 41,070,653	Y311F	possibly damaging	Het
Gprc6a	A	T	10: 51,615,208	V744E	probably damaging	Het
Grin3a	C	T	4: 49,665,510	D1042N	possibly damaging	Het
Gstm3	A	G	3: 107,966,134	C174R	probably damaging	Het
Hectd4	A	G	5: 121,333,424	E2670G	possibly damaging	Het
Hsd3b6	A	T	3: 98,806,187	Y265*	probably null	Het
Hus1	T	A	11: 9,011,110	M1L	probably null	Het
Ifi213	T	G	1: 173,569,102		probably null	Het
Igf2r	A	C	17: 12,698,251	N1587K	probably benign	Het
Ints1	A	T	5: 139,767,750	V709E	probably damaging	Het
Ints8	C	A	4: 11,235,552	R359L	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lrp1b	C	T	2: 41,110,757	E2152K	probably damaging	Het
Lrp2	A	T	2: 69,506,624	V1268D	possibly damaging	Het
Mpo	T	C	11: 87,796,075	Y177H	probably damaging	Het
Mpp4	G	A	1: 59,143,782	P322L	possibly damaging	Het
Mprip	A	G	11: 59,769,891	K2166R	probably damaging	Het
Myo15	T	C	11: 60,491,810	Y1544H	probably damaging	Het
Neu1	G	A	17: 34,934,398	R299Q	probably benign	Het
Nfxl1	C	A	5: 72,514,332		probably null	Het
Nrp2	T	A	1: 62,744,277	I179N	probably damaging	Het
Nup153	A	G	13: 46,693,510		probably null	Het
Olfr130	G	T	17: 38,067,855	R228L	possibly damaging	Het
Olfr350	C	A	2: 36,850,343	A99E	possibly damaging	Het
Olfr474	A	T	7: 107,955,502	H287L	probably benign	Het
Olfr804	A	T	10: 129,705,621	I248L	probably benign	Het
Olfr944	A	T	9: 39,218,022	I222F	probably damaging	Het
P2ry12	A	T	3: 59,217,353	D300E	probably damaging	Het
Pkhd1	C	A	1: 20,553,574	G766*	probably null	Het
Plagl1	A	C	10: 13,128,647		probably benign	Het
Prkcq	A	T	2: 11,232,569	Y53F	probably damaging	Het
Psg18	T	C	7: 18,350,874	E99G	probably damaging	Het
Ptprz1	T	A	6: 23,033,477	H1921Q	probably damaging	Het
Rcc1l	A	G	5: 134,155,790	V391A	probably benign	Het
Sdr42e1	C	T	8: 117,665,024	V11I	probably damaging	Het
Slc12a3	C	A	8: 94,340,530	N404K	probably damaging	Het
Slc38a4	T	C	15: 97,008,997	M287V	probably benign	Het
Slc6a8	A	T	X: 73,676,886	I96F	possibly damaging	Het
Smyd2	A	G	1: 189,897,426	S136P	probably damaging	Het
Sox11	A	G	12: 27,341,703	Y236H	probably damaging	Het
Tbc1d2	G	A	4: 46,637,652	P198L	possibly damaging	Het
Tcof1	G	T	18: 60,835,773	A256E	probably damaging	Het
Tnfsf14	T	A	17: 57,190,867	R122W	probably damaging	Het
Tril	T	C	6: 53,819,083	T385A	probably damaging	Het
Trrap	A	G	5: 144,825,874	T2386A	probably benign	Het
Tspear	T	A	10: 77,870,419	L341H	possibly damaging	Het
Uba7	A	G	9: 107,979,288	M595V	probably benign	Het
Usp43	GC	G	11: 67,855,740		probably null	Het
Utrn	C	A	10: 12,436,364	D616Y	probably damaging	Het
Vmn2r69	T	C	7: 85,410,196	I502V	probably benign	Het
Vps13d	C	A	4: 145,075,047	G419C	probably damaging	Het
Zbtb25	A	T	12: 76,350,106	M114K	probably benign	Het
Zcchc4	A	G	5: 52,796,132	Y161C	probably damaging	Het
Zfp292	A	T	4: 34,808,593	F1484I	possibly damaging	Het
Zfp326	A	G	5: 105,914,780		probably benign	Het
Zfp395	T	A	14: 65,393,116	S372T	probably benign	Het
Zfp423	T	A	8: 87,781,178	E825V	possibly damaging	Het
Zfp445	A	T	9: 122,852,240	Y879N	probably benign	Het
Zfp451	A	G	1: 33,779,167	I77T	possibly damaging	Het
Zfp85	A	T	13: 67,748,884	S356R	probably benign	Het

Other mutations in Tenm4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Tenm4	APN	7	96868009	missense	probably benign	0.00
IGL00468:Tenm4	APN	7	96874472	missense	probably damaging	0.98
IGL00519:Tenm4	APN	7	96805138	splice site	probably benign
IGL00979:Tenm4	APN	7	96729391	missense	probably damaging	0.96
IGL01401:Tenm4	APN	7	96874267	missense	probably damaging	1.00
IGL01459:Tenm4	APN	7	96729385	missense	probably damaging	1.00
IGL01519:Tenm4	APN	7	96895177	missense	probably damaging	1.00
IGL01545:Tenm4	APN	7	96874303	missense	probably benign	0.00
IGL01579:Tenm4	APN	7	96863502	missense	probably benign	0.00
IGL01587:Tenm4	APN	7	96863502	missense	probably benign	0.00
IGL01625:Tenm4	APN	7	96885358	missense	probably damaging	1.00
IGL01655:Tenm4	APN	7	96553724	missense	probably damaging	1.00
IGL01683:Tenm4	APN	7	96885404	missense	possibly damaging	0.84
IGL01728:Tenm4	APN	7	96896064	missense	probably damaging	1.00
IGL01732:Tenm4	APN	7	96895509	missense	probably damaging	1.00
IGL01924:Tenm4	APN	7	96895212	missense	probably damaging	1.00
IGL01966:Tenm4	APN	7	96553550	missense	probably damaging	1.00
IGL02177:Tenm4	APN	7	96895662	missense	probably benign	0.40
IGL02207:Tenm4	APN	7	96874116	missense	possibly damaging	0.85
IGL02269:Tenm4	APN	7	96823822	missense	probably damaging	1.00
IGL02274:Tenm4	APN	7	96854734	missense	probably damaging	1.00
IGL02375:Tenm4	APN	7	96704137	missense	possibly damaging	0.52
IGL02415:Tenm4	APN	7	96874074	missense	probably damaging	0.98
IGL02472:Tenm4	APN	7	96774176	unclassified	probably benign
IGL02656:Tenm4	APN	7	96885433	missense	probably damaging	1.00
IGL02678:Tenm4	APN	7	96896219	missense	probably damaging	1.00
IGL02829:Tenm4	APN	7	96894998	nonsense	probably null
IGL02863:Tenm4	APN	7	96873706	missense	probably damaging	1.00
IGL03145:Tenm4	APN	7	96842968	missense	probably damaging	0.98
IGL03153:Tenm4	APN	7	96873762	missense	probably damaging	1.00
principium	UTSW	7	96797481	missense	probably damaging	0.98
toccata	UTSW	7	96902989	critical splice donor site	probably null
P0026:Tenm4	UTSW	7	96874527	missense	probably damaging	1.00
R0097:Tenm4	UTSW	7	96892926	missense	probably damaging	1.00
R0097:Tenm4	UTSW	7	96892926	missense	probably damaging	1.00
R0140:Tenm4	UTSW	7	96896052	missense	possibly damaging	0.78
R0164:Tenm4	UTSW	7	96729340	splice site	probably benign
R0277:Tenm4	UTSW	7	96694950	missense	possibly damaging	0.54
R0323:Tenm4	UTSW	7	96694950	missense	possibly damaging	0.54
R0362:Tenm4	UTSW	7	96772035	nonsense	probably null
R0381:Tenm4	UTSW	7	96905881	missense	probably damaging	1.00
R0420:Tenm4	UTSW	7	96873766	missense	possibly damaging	0.85
R0426:Tenm4	UTSW	7	96777851	missense	probably damaging	1.00
R0513:Tenm4	UTSW	7	96895623	missense	probably benign	0.35
R0624:Tenm4	UTSW	7	96774020	missense	probably damaging	1.00
R0837:Tenm4	UTSW	7	96896275	splice site	probably benign
R1037:Tenm4	UTSW	7	96797481	missense	probably damaging	0.98
R1172:Tenm4	UTSW	7	96848044	missense	probably damaging	1.00
R1422:Tenm4	UTSW	7	96550051	missense	probably damaging	0.99
R1427:Tenm4	UTSW	7	96843048	missense	probably benign	0.42
R1462:Tenm4	UTSW	7	96704153	missense	probably damaging	1.00
R1462:Tenm4	UTSW	7	96704153	missense	probably damaging	1.00
R1597:Tenm4	UTSW	7	96902989	critical splice donor site	probably null
R1701:Tenm4	UTSW	7	96902889	missense	probably damaging	1.00
R1707:Tenm4	UTSW	7	96888685	missense	probably damaging	1.00
R1809:Tenm4	UTSW	7	96873780	missense	probably benign	0.17
R1812:Tenm4	UTSW	7	96895940	missense	probably damaging	1.00
R1895:Tenm4	UTSW	7	96735808	missense	probably damaging	1.00
R1933:Tenm4	UTSW	7	96895326	missense	probably damaging	1.00
R1946:Tenm4	UTSW	7	96735808	missense	probably damaging	1.00
R2151:Tenm4	UTSW	7	96902847	missense	probably damaging	1.00
R2247:Tenm4	UTSW	7	96906009	missense	probably benign	0.03
R2329:Tenm4	UTSW	7	96895862	missense	probably benign	0.00
R2893:Tenm4	UTSW	7	96894990	missense	probably damaging	1.00
R2990:Tenm4	UTSW	7	96893125	splice site	probably null
R3409:Tenm4	UTSW	7	96895160	missense	probably damaging	1.00
R3410:Tenm4	UTSW	7	96852530	missense	probably damaging	0.99
R3411:Tenm4	UTSW	7	96852530	missense	probably damaging	0.99
R3440:Tenm4	UTSW	7	96553516	missense	probably benign	0.00
R3441:Tenm4	UTSW	7	96553516	missense	probably benign	0.00
R3719:Tenm4	UTSW	7	96863563	missense	possibly damaging	0.92
R3772:Tenm4	UTSW	7	96694880	missense	probably damaging	1.00
R3773:Tenm4	UTSW	7	96694880	missense	probably damaging	1.00
R4093:Tenm4	UTSW	7	96895772	missense	probably damaging	1.00
R4439:Tenm4	UTSW	7	96895815	missense	probably benign	0.01
R4441:Tenm4	UTSW	7	96895815	missense	probably benign	0.01
R4510:Tenm4	UTSW	7	96894863	missense	probably benign
R4511:Tenm4	UTSW	7	96894863	missense	probably benign
R4543:Tenm4	UTSW	7	96895815	missense	probably benign	0.01
R4645:Tenm4	UTSW	7	96895742	missense	probably damaging	1.00
R4701:Tenm4	UTSW	7	96895349	missense	probably damaging	1.00
R4707:Tenm4	UTSW	7	96774046	missense	probably damaging	0.99
R4714:Tenm4	UTSW	7	96894924	missense	probably damaging	1.00
R4742:Tenm4	UTSW	7	96797484	missense	probably damaging	0.99
R4784:Tenm4	UTSW	7	96774046	missense	probably damaging	0.99
R4785:Tenm4	UTSW	7	96774046	missense	probably damaging	0.99
R4801:Tenm4	UTSW	7	96906245	missense	probably damaging	0.97
R4802:Tenm4	UTSW	7	96906245	missense	probably damaging	0.97
R4880:Tenm4	UTSW	7	96905818	splice site	probably null
R5036:Tenm4	UTSW	7	96694790	missense	probably damaging	1.00
R5036:Tenm4	UTSW	7	96852561	missense	probably damaging	1.00
R5050:Tenm4	UTSW	7	96895788	missense	probably damaging	1.00
R5103:Tenm4	UTSW	7	96842957	missense	probably damaging	1.00
R5106:Tenm4	UTSW	7	96843149	missense	probably damaging	0.99
R5118:Tenm4	UTSW	7	96893086	missense	probably damaging	1.00
R5272:Tenm4	UTSW	7	96874203	missense	probably damaging	0.98
R5282:Tenm4	UTSW	7	96837331	missense	possibly damaging	0.90
R5403:Tenm4	UTSW	7	96888827	missense	probably damaging	1.00
R5404:Tenm4	UTSW	7	96894680	missense	probably damaging	1.00
R5567:Tenm4	UTSW	7	96896209	nonsense	probably null
R5590:Tenm4	UTSW	7	96797400	missense	possibly damaging	0.73
R5590:Tenm4	UTSW	7	96797401	missense	possibly damaging	0.93
R5597:Tenm4	UTSW	7	96553517	missense	probably benign	0.00
R5782:Tenm4	UTSW	7	96893039	missense	probably benign	0.00
R5861:Tenm4	UTSW	7	96843217	intron	probably benign
R5890:Tenm4	UTSW	7	96902860	missense	probably damaging	1.00
R5930:Tenm4	UTSW	7	96854719	missense	probably damaging	1.00
R5940:Tenm4	UTSW	7	96845895	missense	probably damaging	1.00
R6012:Tenm4	UTSW	7	96522433	intron	probably benign
R6060:Tenm4	UTSW	7	96873711	missense	probably damaging	1.00
R6104:Tenm4	UTSW	7	96837289	missense	probably damaging	0.97
R6283:Tenm4	UTSW	7	96874494	missense	probably benign	0.33
R6333:Tenm4	UTSW	7	96774124	missense	probably damaging	1.00
R6522:Tenm4	UTSW	7	96843044	missense	possibly damaging	0.88
R6616:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R6746:Tenm4	UTSW	7	96892860	missense	probably damaging	1.00
R6751:Tenm4	UTSW	7	96845712	missense	possibly damaging	0.95
R6806:Tenm4	UTSW	7	96811959	missense	possibly damaging	0.95
R6807:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R6807:Tenm4	UTSW	7	96895271	missense	probably damaging	1.00
R6809:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R6810:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R6811:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R6853:Tenm4	UTSW	7	96837295	missense	possibly damaging	0.94
R6886:Tenm4	UTSW	7	96797392	missense	possibly damaging	0.85
R6920:Tenm4	UTSW	7	96895550	missense	probably damaging	1.00
R6937:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R6939:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R7011:Tenm4	UTSW	7	96896135	nonsense	probably null
R7033:Tenm4	UTSW	7	96895223	nonsense	probably null
R7040:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R7083:Tenm4	UTSW	7	96895349	missense	probably damaging	1.00
R7238:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R7239:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R7239:Tenm4	UTSW	7	96735813	missense	possibly damaging	0.47
R7337:Tenm4	UTSW	7	96874126	missense	probably benign	0.44
R7400:Tenm4	UTSW	7	96694803	missense	probably damaging	0.97
R7407:Tenm4	UTSW	7	96773987	missense	possibly damaging	0.89
R7449:Tenm4	UTSW	7	96874213	missense	possibly damaging	0.65
R7473:Tenm4	UTSW	7	96774146	missense	probably damaging	1.00
R7477:Tenm4	UTSW	7	96845808	missense	probably damaging	0.99
R7489:Tenm4	UTSW	7	96837314	missense	possibly damaging	0.90
R7498:Tenm4	UTSW	7	96848017	missense	probably damaging	1.00
R7562:Tenm4	UTSW	7	96888814	missense	probably damaging	1.00
R7615:Tenm4	UTSW	7	96845926	missense	probably damaging	1.00
R7624:Tenm4	UTSW	7	96895985	missense	possibly damaging	0.95
R7626:Tenm4	UTSW	7	96893014	missense	probably damaging	1.00
R7690:Tenm4	UTSW	7	96863533	missense	probably benign	0.00
R7692:Tenm4	UTSW	7	96895403	missense	probably damaging	1.00
R7748:Tenm4	UTSW	7	96894702	missense	probably damaging	1.00
R7763:Tenm4	UTSW	7	96895692	missense	probably benign	0.38
R7792:Tenm4	UTSW	7	96774014	missense	possibly damaging	0.54
R7855:Tenm4	UTSW	7	96873874	missense	probably damaging	1.00
R7868:Tenm4	UTSW	7	96906380	missense	possibly damaging	0.79
R7878:Tenm4	UTSW	7	96852357	missense	probably damaging	1.00
R7997:Tenm4	UTSW	7	96874305	missense	probably benign	0.44
R8017:Tenm4	UTSW	7	96704041	missense	probably damaging	1.00
R8019:Tenm4	UTSW	7	96704041	missense	probably damaging	1.00
R8054:Tenm4	UTSW	7	96729346	splice site	probably benign
R8061:Tenm4	UTSW	7	96852456	missense	probably damaging	1.00
R8108:Tenm4	UTSW	7	96854728	missense	probably benign	0.39
R8140:Tenm4	UTSW	7	96895176	missense	probably damaging	1.00
R8214:Tenm4	UTSW	7	96895407	missense	probably damaging	1.00
R8258:Tenm4	UTSW	7	96867991	missense	probably damaging	1.00
R8259:Tenm4	UTSW	7	96867991	missense	probably damaging	1.00
R8364:Tenm4	UTSW	7	96772106	critical splice donor site	probably null
R8542:Tenm4	UTSW	7	96811932	missense	probably damaging	0.99
R8669:Tenm4	UTSW	7	96905941	missense	probably benign
R8670:Tenm4	UTSW	7	96905941	missense	probably benign
R8683:Tenm4	UTSW	7	96902857	missense	probably damaging	0.99
R8691:Tenm4	UTSW	7	96905941	missense	probably benign
R8692:Tenm4	UTSW	7	96905941	missense	probably benign
R8714:Tenm4	UTSW	7	96905941	missense	probably benign
R8716:Tenm4	UTSW	7	96905941	missense	probably benign
R8735:Tenm4	UTSW	7	96905941	missense	probably benign
R8736:Tenm4	UTSW	7	96905941	missense	probably benign
R8737:Tenm4	UTSW	7	96905941	missense	probably benign
R8738:Tenm4	UTSW	7	96873840	missense	probably damaging	1.00
R8738:Tenm4	UTSW	7	96905941	missense	probably benign
R8739:Tenm4	UTSW	7	96905941	missense	probably benign
R8776:Tenm4	UTSW	7	96895032	missense	probably damaging	1.00
R8776-TAIL:Tenm4	UTSW	7	96895032	missense	probably damaging	1.00
R8777:Tenm4	UTSW	7	96896037	missense	probably damaging	1.00
R8777-TAIL:Tenm4	UTSW	7	96896037	missense	probably damaging	1.00
R8817:Tenm4	UTSW	7	96874128	missense	probably benign	0.01
R8851:Tenm4	UTSW	7	96852503	missense	probably damaging	1.00
R8913:Tenm4	UTSW	7	96702745	splice site	probably benign
R8977:Tenm4	UTSW	7	96811970	missense	probably damaging	1.00
R9100:Tenm4	UTSW	7	96845854	missense	probably damaging	1.00
R9136:Tenm4	UTSW	7	96823918	missense	possibly damaging	0.69
R9163:Tenm4	UTSW	7	96823873	missense	probably damaging	1.00
R9188:Tenm4	UTSW	7	96772027	missense	probably damaging	1.00
R9195:Tenm4	UTSW	7	96892919	missense	probably damaging	1.00
R9217:Tenm4	UTSW	7	96885439	missense	probably damaging	1.00
R9344:Tenm4	UTSW	7	96896145	missense	probably damaging	1.00
R9414:Tenm4	UTSW	7	96896160	missense	probably benign
R9466:Tenm4	UTSW	7	96550045	missense	possibly damaging	0.79
R9559:Tenm4	UTSW	7	96823849	missense	probably benign
R9626:Tenm4	UTSW	7	96896138	missense	probably damaging	1.00
R9673:Tenm4	UTSW	7	96867989	missense	probably damaging	1.00
R9676:Tenm4	UTSW	7	96895431	missense	probably damaging	1.00
R9678:Tenm4	UTSW	7	96737412	missense	possibly damaging	0.94
R9775:Tenm4	UTSW	7	96906554	missense	possibly damaging	0.92
R9790:Tenm4	UTSW	7	96888839	missense	probably damaging	1.00
R9791:Tenm4	UTSW	7	96888839	missense	probably damaging	1.00
R9803:Tenm4	UTSW	7	96553478	missense	probably damaging	1.00
X0021:Tenm4	UTSW	7	96873909	nonsense	probably null
X0026:Tenm4	UTSW	7	96868087	missense	probably damaging	0.98
X0066:Tenm4	UTSW	7	96848030	missense	probably damaging	1.00
X0066:Tenm4	UTSW	7	96894794	missense	probably damaging	1.00
Z1176:Tenm4	UTSW	7	96905914	missense	probably benign	0.00
Z1177:Tenm4	UTSW	7	96863585	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CTAGAGAACCTTCACTTCACCATTG -3'
(R):5'- AAGAAGCCGTCGTAGCCTTG -3'

Sequencing Primer
(F):5'- CCATTGATGGGGTGGACAC -3'
(R):5'- TCGTAGCCTTGCACCCG -3'

Posted On

2014-09-18