Mutagenetix > Incidental Mutations

Incidental Mutation 'R2108:Olfr944'

232266

Institutional Source

Beutler Lab

Gene Symbol

Olfr944

Ensembl Gene

ENSMUSG00000096555

Gene Name

olfactory receptor 944

Synonyms

GA_x6K02T2PVTD-32914568-32915503, MOR171-19

MMRRC Submission

040112-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.092) question?

Stock #

R2108 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

39201920-39218421 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 39218022 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 222 (I222F)

Ref Sequence

ENSEMBL: ENSMUSP00000150471 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079650] [ENSMUST00000213908] [ENSMUST00000215306]

Predicted Effect

probably damaging
Transcript: ENSMUST00000079650
AA Change: I222F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000078595
Gene: ENSMUSG00000096555
AA Change: I222F

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	2.5e-47	PFAM
Pfam:7tm_1	41	290	2.1e-19	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000213908
AA Change: I222F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000215306
AA Change: I222F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd10	A	G	16: 45,731,940	M190T	probably benign	Het
Abhd5	A	G	9: 122,377,940	Y250C	probably damaging	Het
Ace2	A	G	X: 164,140,732	N24S	probably benign	Het
Adamtsl2	A	G	2: 27,095,558	M485V	probably benign	Het
Adamtsl4	G	T	3: 95,681,047	P577H	probably damaging	Het
Akap8l	C	T	17: 32,332,483	R511H	probably damaging	Het
Apc	T	C	18: 34,269,229	Y141H	probably damaging	Het
Arsi	A	T	18: 60,916,371	T109S	possibly damaging	Het
Asb3	G	A	11: 31,081,355		probably null	Het
Atm	T	C	9: 53,443,997	D2899G	probably damaging	Het
Bcas3	G	A	11: 85,457,878	V199I	probably damaging	Het
Bub1	T	C	2: 127,819,335	K279E	probably damaging	Het
C3	A	T	17: 57,223,974		probably null	Het
Cabcoco1	T	C	10: 68,431,323	K185E	probably benign	Het
Cadm2	A	T	16: 66,731,471	I326N	probably benign	Het
Ccr3	T	C	9: 124,029,299	S224P	possibly damaging	Het
Cdhr4	A	G	9: 107,997,644	T638A	probably damaging	Het
Cfap46	T	C	7: 139,683,761	I4V	probably benign	Het
Csf2rb2	A	T	15: 78,292,544	V216E	probably damaging	Het
Csmd3	A	T	15: 48,004,861	D754E	possibly damaging	Het
Dnaaf1	T	C	8: 119,582,732		probably null	Het
Dnah11	A	C	12: 118,020,353	Y2466D	probably damaging	Het
Dtx2	C	T	5: 136,030,577	S493F	probably damaging	Het
E2f7	T	C	10: 110,780,902	Y668H	probably benign	Het
Ehmt1	A	T	2: 24,837,618	S735T	probably damaging	Het
Eomes	T	C	9: 118,478,852	F65L	probably benign	Het
Ercc6l2	T	C	13: 63,871,988		probably benign	Het
Fbrsl1	A	T	5: 110,378,434	L439Q	probably damaging	Het
Fyco1	C	T	9: 123,797,516		probably null	Het
Gfm2	A	G	13: 97,155,442	T229A	probably benign	Het
Gm7735	G	A	16: 89,169,545	G19D	unknown	Het
Gm9745	G	A	13: 8,941,728	P221S	possibly damaging	Het
Gnpda1	T	C	18: 38,333,190		probably null	Het
Gpr6	T	A	10: 41,070,653	Y311F	possibly damaging	Het
Gprc6a	A	T	10: 51,615,208	V744E	probably damaging	Het
Grin3a	C	T	4: 49,665,510	D1042N	possibly damaging	Het
Gstm3	A	G	3: 107,966,134	C174R	probably damaging	Het
Hectd4	A	G	5: 121,333,424	E2670G	possibly damaging	Het
Hsd3b6	A	T	3: 98,806,187	Y265*	probably null	Het
Hus1	T	A	11: 9,011,110	M1L	probably null	Het
Ifi213	T	G	1: 173,569,102		probably null	Het
Igf2r	A	C	17: 12,698,251	N1587K	probably benign	Het
Ints1	A	T	5: 139,767,750	V709E	probably damaging	Het
Ints8	C	A	4: 11,235,552	R359L	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lrp1b	C	T	2: 41,110,757	E2152K	probably damaging	Het
Lrp2	A	T	2: 69,506,624	V1268D	possibly damaging	Het
Mpo	T	C	11: 87,796,075	Y177H	probably damaging	Het
Mpp4	G	A	1: 59,143,782	P322L	possibly damaging	Het
Mprip	A	G	11: 59,769,891	K2166R	probably damaging	Het
Myo15	T	C	11: 60,491,810	Y1544H	probably damaging	Het
Neu1	G	A	17: 34,934,398	R299Q	probably benign	Het
Nfxl1	C	A	5: 72,514,332		probably null	Het
Nrp2	T	A	1: 62,744,277	I179N	probably damaging	Het
Nup153	A	G	13: 46,693,510		probably null	Het
Olfr130	G	T	17: 38,067,855	R228L	possibly damaging	Het
Olfr350	C	A	2: 36,850,343	A99E	possibly damaging	Het
Olfr474	A	T	7: 107,955,502	H287L	probably benign	Het
Olfr804	A	T	10: 129,705,621	I248L	probably benign	Het
P2ry12	A	T	3: 59,217,353	D300E	probably damaging	Het
Pkhd1	C	A	1: 20,553,574	G766*	probably null	Het
Plagl1	A	C	10: 13,128,647		probably benign	Het
Prkcq	A	T	2: 11,232,569	Y53F	probably damaging	Het
Psg18	T	C	7: 18,350,874	E99G	probably damaging	Het
Ptprz1	T	A	6: 23,033,477	H1921Q	probably damaging	Het
Rcc1l	A	G	5: 134,155,790	V391A	probably benign	Het
Sdr42e1	C	T	8: 117,665,024	V11I	probably damaging	Het
Slc12a3	C	A	8: 94,340,530	N404K	probably damaging	Het
Slc38a4	T	C	15: 97,008,997	M287V	probably benign	Het
Slc6a8	A	T	X: 73,676,886	I96F	possibly damaging	Het
Smyd2	A	G	1: 189,897,426	S136P	probably damaging	Het
Sox11	A	G	12: 27,341,703	Y236H	probably damaging	Het
Tbc1d2	G	A	4: 46,637,652	P198L	possibly damaging	Het
Tcof1	G	T	18: 60,835,773	A256E	probably damaging	Het
Tenm4	A	G	7: 96,906,290	Y2726C	probably damaging	Het
Tnfsf14	T	A	17: 57,190,867	R122W	probably damaging	Het
Tril	T	C	6: 53,819,083	T385A	probably damaging	Het
Trrap	A	G	5: 144,825,874	T2386A	probably benign	Het
Tspear	T	A	10: 77,870,419	L341H	possibly damaging	Het
Uba7	A	G	9: 107,979,288	M595V	probably benign	Het
Usp43	GC	G	11: 67,855,740		probably null	Het
Utrn	C	A	10: 12,436,364	D616Y	probably damaging	Het
Vmn2r69	T	C	7: 85,410,196	I502V	probably benign	Het
Vps13d	C	A	4: 145,075,047	G419C	probably damaging	Het
Zbtb25	A	T	12: 76,350,106	M114K	probably benign	Het
Zcchc4	A	G	5: 52,796,132	Y161C	probably damaging	Het
Zfp292	A	T	4: 34,808,593	F1484I	possibly damaging	Het
Zfp326	A	G	5: 105,914,780		probably benign	Het
Zfp395	T	A	14: 65,393,116	S372T	probably benign	Het
Zfp423	T	A	8: 87,781,178	E825V	possibly damaging	Het
Zfp445	A	T	9: 122,852,240	Y879N	probably benign	Het
Zfp451	A	G	1: 33,779,167	I77T	possibly damaging	Het
Zfp85	A	T	13: 67,748,884	S356R	probably benign	Het

Other mutations in Olfr944

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01096:Olfr944	APN	9	39218116	missense	probably damaging	1.00
IGL01529:Olfr944	APN	9	39218131	missense	probably benign	0.30
IGL03307:Olfr944	APN	9	39218013	missense	probably benign	0.03
R0110:Olfr944	UTSW	9	39217728	missense	possibly damaging	0.50
R0413:Olfr944	UTSW	9	39218270	missense	probably benign	0.25
R0450:Olfr944	UTSW	9	39217728	missense	possibly damaging	0.50
R2112:Olfr944	UTSW	9	39217779	missense	probably benign	0.01
R4666:Olfr944	UTSW	9	39217846	missense	probably damaging	0.97
R5039:Olfr944	UTSW	9	39218114	nonsense	probably null
R6384:Olfr944	UTSW	9	39217978	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- CACTGGCTTCATGTTTAGGATTCAG -3'
(R):5'- CAGGCTGTAGATGAAGGGGTTC -3'

Sequencing Primer
(F):5'- GCTTCATGTTTAGGATTCAGTTCTG -3'
(R):5'- GTTCAGCATGGGTACAACTGTAGTAC -3'

Posted On

2014-09-18