Incidental Mutation 'R2108:Abhd5'
ID232272
Institutional Source Beutler Lab
Gene Symbol Abhd5
Ensembl Gene ENSMUSG00000032540
Gene Nameabhydrolase domain containing 5
SynonymsNCIE2, IECN5, 2010002J10Rik, CGI-58, 1300003D03Rik
MMRRC Submission 040112-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2108 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location122351608-122381524 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122377940 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 250 (Y250C)
Ref Sequence ENSEMBL: ENSMUSP00000122274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035128] [ENSMUST00000111497] [ENSMUST00000156520] [ENSMUST00000175973]
Predicted Effect probably benign
Transcript: ENSMUST00000035128
Predicted Effect probably damaging
Transcript: ENSMUST00000111497
AA Change: Y97C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107123
Gene: ENSMUSG00000032540
AA Change: Y97C

DomainStartEndE-ValueType
Pfam:Abhydrolase_6 3 189 7.8e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000156520
AA Change: Y250C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122274
Gene: ENSMUSG00000032540
AA Change: Y250C

DomainStartEndE-ValueType
Pfam:Hydrolase_4 75 246 4.1e-11 PFAM
Pfam:Abhydrolase_1 78 208 6e-20 PFAM
Pfam:Abhydrolase_5 79 330 6.7e-11 PFAM
Pfam:Abhydrolase_6 80 342 8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175973
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177015
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a large family of proteins defined by an alpha/beta hydrolase fold, and contains three sequence motifs that correspond to a catalytic triad found in the esterase/lipase/thioesterase subfamily. It differs from other members of this subfamily in that its putative catalytic triad contains an asparagine instead of the serine residue. Mutations in this gene have been associated with Chanarin-Dorfman syndrome, a triglyceride storage disease with impaired long-chain fatty acid oxidation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit growth retardation, impaired triacylglycerol catabolism, hepatic steatosis, and lethal skin barrier defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd10 A G 16: 45,731,940 M190T probably benign Het
Ace2 A G X: 164,140,732 N24S probably benign Het
Adamtsl2 A G 2: 27,095,558 M485V probably benign Het
Adamtsl4 G T 3: 95,681,047 P577H probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Apc T C 18: 34,269,229 Y141H probably damaging Het
Arsi A T 18: 60,916,371 T109S possibly damaging Het
Asb3 G A 11: 31,081,355 probably null Het
Atm T C 9: 53,443,997 D2899G probably damaging Het
Bcas3 G A 11: 85,457,878 V199I probably damaging Het
Bub1 T C 2: 127,819,335 K279E probably damaging Het
C3 A T 17: 57,223,974 probably null Het
Cabcoco1 T C 10: 68,431,323 K185E probably benign Het
Cadm2 A T 16: 66,731,471 I326N probably benign Het
Ccr3 T C 9: 124,029,299 S224P possibly damaging Het
Cdhr4 A G 9: 107,997,644 T638A probably damaging Het
Cfap46 T C 7: 139,683,761 I4V probably benign Het
Csf2rb2 A T 15: 78,292,544 V216E probably damaging Het
Csmd3 A T 15: 48,004,861 D754E possibly damaging Het
Dnaaf1 T C 8: 119,582,732 probably null Het
Dnah11 A C 12: 118,020,353 Y2466D probably damaging Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
E2f7 T C 10: 110,780,902 Y668H probably benign Het
Ehmt1 A T 2: 24,837,618 S735T probably damaging Het
Eomes T C 9: 118,478,852 F65L probably benign Het
Ercc6l2 T C 13: 63,871,988 probably benign Het
Fbrsl1 A T 5: 110,378,434 L439Q probably damaging Het
Fyco1 C T 9: 123,797,516 probably null Het
Gfm2 A G 13: 97,155,442 T229A probably benign Het
Gm7735 G A 16: 89,169,545 G19D unknown Het
Gm9745 G A 13: 8,941,728 P221S possibly damaging Het
Gnpda1 T C 18: 38,333,190 probably null Het
Gpr6 T A 10: 41,070,653 Y311F possibly damaging Het
Gprc6a A T 10: 51,615,208 V744E probably damaging Het
Grin3a C T 4: 49,665,510 D1042N possibly damaging Het
Gstm3 A G 3: 107,966,134 C174R probably damaging Het
Hectd4 A G 5: 121,333,424 E2670G possibly damaging Het
Hsd3b6 A T 3: 98,806,187 Y265* probably null Het
Hus1 T A 11: 9,011,110 M1L probably null Het
Ifi213 T G 1: 173,569,102 probably null Het
Igf2r A C 17: 12,698,251 N1587K probably benign Het
Ints1 A T 5: 139,767,750 V709E probably damaging Het
Ints8 C A 4: 11,235,552 R359L probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrp1b C T 2: 41,110,757 E2152K probably damaging Het
Lrp2 A T 2: 69,506,624 V1268D possibly damaging Het
Mpo T C 11: 87,796,075 Y177H probably damaging Het
Mpp4 G A 1: 59,143,782 P322L possibly damaging Het
Mprip A G 11: 59,769,891 K2166R probably damaging Het
Myo15 T C 11: 60,491,810 Y1544H probably damaging Het
Neu1 G A 17: 34,934,398 R299Q probably benign Het
Nfxl1 C A 5: 72,514,332 probably null Het
Nrp2 T A 1: 62,744,277 I179N probably damaging Het
Nup153 A G 13: 46,693,510 probably null Het
Olfr130 G T 17: 38,067,855 R228L possibly damaging Het
Olfr350 C A 2: 36,850,343 A99E possibly damaging Het
Olfr474 A T 7: 107,955,502 H287L probably benign Het
Olfr804 A T 10: 129,705,621 I248L probably benign Het
Olfr944 A T 9: 39,218,022 I222F probably damaging Het
P2ry12 A T 3: 59,217,353 D300E probably damaging Het
Pkhd1 C A 1: 20,553,574 G766* probably null Het
Plagl1 A C 10: 13,128,647 probably benign Het
Prkcq A T 2: 11,232,569 Y53F probably damaging Het
Psg18 T C 7: 18,350,874 E99G probably damaging Het
Ptprz1 T A 6: 23,033,477 H1921Q probably damaging Het
Rcc1l A G 5: 134,155,790 V391A probably benign Het
Sdr42e1 C T 8: 117,665,024 V11I probably damaging Het
Slc12a3 C A 8: 94,340,530 N404K probably damaging Het
Slc38a4 T C 15: 97,008,997 M287V probably benign Het
Slc6a8 A T X: 73,676,886 I96F possibly damaging Het
Smyd2 A G 1: 189,897,426 S136P probably damaging Het
Sox11 A G 12: 27,341,703 Y236H probably damaging Het
Tbc1d2 G A 4: 46,637,652 P198L possibly damaging Het
Tcof1 G T 18: 60,835,773 A256E probably damaging Het
Tenm4 A G 7: 96,906,290 Y2726C probably damaging Het
Tnfsf14 T A 17: 57,190,867 R122W probably damaging Het
Tril T C 6: 53,819,083 T385A probably damaging Het
Trrap A G 5: 144,825,874 T2386A probably benign Het
Tspear T A 10: 77,870,419 L341H possibly damaging Het
Uba7 A G 9: 107,979,288 M595V probably benign Het
Usp43 GC G 11: 67,855,740 probably null Het
Utrn C A 10: 12,436,364 D616Y probably damaging Het
Vmn2r69 T C 7: 85,410,196 I502V probably benign Het
Vps13d C A 4: 145,075,047 G419C probably damaging Het
Zbtb25 A T 12: 76,350,106 M114K probably benign Het
Zcchc4 A G 5: 52,796,132 Y161C probably damaging Het
Zfp292 A T 4: 34,808,593 F1484I possibly damaging Het
Zfp326 A G 5: 105,914,780 probably benign Het
Zfp395 T A 14: 65,393,116 S372T probably benign Het
Zfp423 T A 8: 87,781,178 E825V possibly damaging Het
Zfp445 A T 9: 122,852,240 Y879N probably benign Het
Zfp451 A G 1: 33,779,167 I77T possibly damaging Het
Zfp85 A T 13: 67,748,884 S356R probably benign Het
Other mutations in Abhd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Abhd5 APN 9 122368081 missense possibly damaging 0.73
IGL02143:Abhd5 APN 9 122365213 start codon destroyed probably null 0.01
IGL02949:Abhd5 APN 9 122377915 missense possibly damaging 0.51
IGL03248:Abhd5 APN 9 122368225 missense probably damaging 1.00
R0363:Abhd5 UTSW 9 122368146 missense possibly damaging 0.61
R1519:Abhd5 UTSW 9 122379014 splice site probably null
R4818:Abhd5 UTSW 9 122363800 splice site probably null
R5048:Abhd5 UTSW 9 122377903 missense probably damaging 1.00
R5786:Abhd5 UTSW 9 122363803 splice site probably null
R6141:Abhd5 UTSW 9 122377933 missense probably benign 0.01
R6901:Abhd5 UTSW 9 122368155 missense probably benign 0.18
R7296:Abhd5 UTSW 9 122379573 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- AAAAGCAATGTCCGGGATGTATAC -3'
(R):5'- GGTCACGTCCTTAGACTTTGC -3'

Sequencing Primer
(F):5'- GTCCGGGATGTATACTTTTTCCAAC -3'
(R):5'- TCTACTCTTACCTTGCCCAAAG -3'
Posted On2014-09-18