Incidental Mutation 'R2108:Plagl1'
ID232277
Institutional Source Beutler Lab
Gene Symbol Plagl1
Ensembl Gene ENSMUSG00000019817
Gene Namepleiomorphic adenoma gene-like 1
SynonymsZac1
MMRRC Submission 040112-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.324) question?
Stock #R2108 (G1)
Quality Score128
Status Not validated
Chromosome10
Chromosomal Location13060504-13131694 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to C at 13128647 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121325] [ENSMUST00000121646] [ENSMUST00000121766] [ENSMUST00000130313] [ENSMUST00000143582] [ENSMUST00000145103] [ENSMUST00000193426]
Predicted Effect unknown
Transcript: ENSMUST00000121325
AA Change: Q553P
SMART Domains Protein: ENSMUSP00000112889
Gene: ENSMUSG00000019817
AA Change: Q553P

DomainStartEndE-ValueType
ZnF_C2H2 4 26 2.36e-2 SMART
ZnF_C2H2 32 56 7.9e-4 SMART
ZnF_C2H2 62 84 2.95e-3 SMART
ZnF_C2H2 91 113 2.71e-2 SMART
ZnF_C2H2 120 142 6.57e0 SMART
ZnF_C2H2 156 178 6.32e-3 SMART
ZnF_C2H2 184 207 1.25e-1 SMART
low complexity region 270 385 N/A INTRINSIC
coiled coil region 640 657 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000121646
AA Change: Q553P
SMART Domains Protein: ENSMUSP00000112847
Gene: ENSMUSG00000019817
AA Change: Q553P

DomainStartEndE-ValueType
ZnF_C2H2 4 26 2.36e-2 SMART
ZnF_C2H2 32 56 7.9e-4 SMART
ZnF_C2H2 62 84 2.95e-3 SMART
ZnF_C2H2 91 113 2.71e-2 SMART
ZnF_C2H2 120 142 6.57e0 SMART
ZnF_C2H2 156 178 6.32e-3 SMART
ZnF_C2H2 184 207 1.25e-1 SMART
low complexity region 270 385 N/A INTRINSIC
coiled coil region 640 657 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000121766
AA Change: Q553P
SMART Domains Protein: ENSMUSP00000113710
Gene: ENSMUSG00000019817
AA Change: Q553P

DomainStartEndE-ValueType
ZnF_C2H2 4 26 2.36e-2 SMART
ZnF_C2H2 32 56 7.9e-4 SMART
ZnF_C2H2 62 84 2.95e-3 SMART
ZnF_C2H2 91 113 2.71e-2 SMART
ZnF_C2H2 120 142 6.57e0 SMART
ZnF_C2H2 156 178 6.32e-3 SMART
ZnF_C2H2 184 207 1.25e-1 SMART
low complexity region 270 385 N/A INTRINSIC
coiled coil region 640 657 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124252
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126880
Predicted Effect probably benign
Transcript: ENSMUST00000130313
SMART Domains Protein: ENSMUSP00000117321
Gene: ENSMUSG00000019817

DomainStartEndE-ValueType
ZnF_C2H2 4 26 2.36e-2 SMART
ZnF_C2H2 32 56 7.9e-4 SMART
ZnF_C2H2 62 84 2.95e-3 SMART
ZnF_C2H2 91 113 2.71e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135095
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135261
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141068
Predicted Effect probably benign
Transcript: ENSMUST00000143582
Predicted Effect probably benign
Transcript: ENSMUST00000145103
Predicted Effect probably benign
Transcript: ENSMUST00000193426
SMART Domains Protein: ENSMUSP00000141514
Gene: ENSMUSG00000019817

DomainStartEndE-ValueType
ZnF_C2H2 4 26 1e-4 SMART
ZnF_C2H2 32 56 3.2e-6 SMART
ZnF_C2H2 62 84 1.3e-5 SMART
ZnF_C2H2 91 113 1.1e-4 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a C2H2 zinc finger protein that functions as a suppressor of cell growth. This gene is often deleted or methylated and silenced in cancer cells. In addition, overexpression of this gene during fetal development is thought to be the causal factor for transient neonatal diabetes mellitus (TNDM). Alternative splicing and the use of alternative promoters results in multiple transcript variants encoding two different protein isoforms. The P1 downstream promoter of this gene is imprinted, with preferential expression from the paternal allele in many tissues. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice exhibit significantly reduced birth weights. Heterozygous mice with a paternal copy of the null allele show reduced fetal and birth weights, altered ossification, dyspnea and background-dependent neonatal lethality, as well as wrinkled skin and curly tails with 30% penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd10 A G 16: 45,731,940 M190T probably benign Het
Abhd5 A G 9: 122,377,940 Y250C probably damaging Het
Ace2 A G X: 164,140,732 N24S probably benign Het
Adamtsl2 A G 2: 27,095,558 M485V probably benign Het
Adamtsl4 G T 3: 95,681,047 P577H probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Apc T C 18: 34,269,229 Y141H probably damaging Het
Arsi A T 18: 60,916,371 T109S possibly damaging Het
Asb3 G A 11: 31,081,355 probably null Het
Atm T C 9: 53,443,997 D2899G probably damaging Het
Bcas3 G A 11: 85,457,878 V199I probably damaging Het
Bub1 T C 2: 127,819,335 K279E probably damaging Het
C3 A T 17: 57,223,974 probably null Het
Cabcoco1 T C 10: 68,431,323 K185E probably benign Het
Cadm2 A T 16: 66,731,471 I326N probably benign Het
Ccr3 T C 9: 124,029,299 S224P possibly damaging Het
Cdhr4 A G 9: 107,997,644 T638A probably damaging Het
Cfap46 T C 7: 139,683,761 I4V probably benign Het
Csf2rb2 A T 15: 78,292,544 V216E probably damaging Het
Csmd3 A T 15: 48,004,861 D754E possibly damaging Het
Dnaaf1 T C 8: 119,582,732 probably null Het
Dnah11 A C 12: 118,020,353 Y2466D probably damaging Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
E2f7 T C 10: 110,780,902 Y668H probably benign Het
Ehmt1 A T 2: 24,837,618 S735T probably damaging Het
Eomes T C 9: 118,478,852 F65L probably benign Het
Ercc6l2 T C 13: 63,871,988 probably benign Het
Fbrsl1 A T 5: 110,378,434 L439Q probably damaging Het
Fyco1 C T 9: 123,797,516 probably null Het
Gfm2 A G 13: 97,155,442 T229A probably benign Het
Gm7735 G A 16: 89,169,545 G19D unknown Het
Gm9745 G A 13: 8,941,728 P221S possibly damaging Het
Gnpda1 T C 18: 38,333,190 probably null Het
Gpr6 T A 10: 41,070,653 Y311F possibly damaging Het
Gprc6a A T 10: 51,615,208 V744E probably damaging Het
Grin3a C T 4: 49,665,510 D1042N possibly damaging Het
Gstm3 A G 3: 107,966,134 C174R probably damaging Het
Hectd4 A G 5: 121,333,424 E2670G possibly damaging Het
Hsd3b6 A T 3: 98,806,187 Y265* probably null Het
Hus1 T A 11: 9,011,110 M1L probably null Het
Ifi213 T G 1: 173,569,102 probably null Het
Igf2r A C 17: 12,698,251 N1587K probably benign Het
Ints1 A T 5: 139,767,750 V709E probably damaging Het
Ints8 C A 4: 11,235,552 R359L probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrp1b C T 2: 41,110,757 E2152K probably damaging Het
Lrp2 A T 2: 69,506,624 V1268D possibly damaging Het
Mpo T C 11: 87,796,075 Y177H probably damaging Het
Mpp4 G A 1: 59,143,782 P322L possibly damaging Het
Mprip A G 11: 59,769,891 K2166R probably damaging Het
Myo15 T C 11: 60,491,810 Y1544H probably damaging Het
Neu1 G A 17: 34,934,398 R299Q probably benign Het
Nfxl1 C A 5: 72,514,332 probably null Het
Nrp2 T A 1: 62,744,277 I179N probably damaging Het
Nup153 A G 13: 46,693,510 probably null Het
Olfr130 G T 17: 38,067,855 R228L possibly damaging Het
Olfr350 C A 2: 36,850,343 A99E possibly damaging Het
Olfr474 A T 7: 107,955,502 H287L probably benign Het
Olfr804 A T 10: 129,705,621 I248L probably benign Het
Olfr944 A T 9: 39,218,022 I222F probably damaging Het
P2ry12 A T 3: 59,217,353 D300E probably damaging Het
Pkhd1 C A 1: 20,553,574 G766* probably null Het
Prkcq A T 2: 11,232,569 Y53F probably damaging Het
Psg18 T C 7: 18,350,874 E99G probably damaging Het
Ptprz1 T A 6: 23,033,477 H1921Q probably damaging Het
Rcc1l A G 5: 134,155,790 V391A probably benign Het
Sdr42e1 C T 8: 117,665,024 V11I probably damaging Het
Slc12a3 C A 8: 94,340,530 N404K probably damaging Het
Slc38a4 T C 15: 97,008,997 M287V probably benign Het
Slc6a8 A T X: 73,676,886 I96F possibly damaging Het
Smyd2 A G 1: 189,897,426 S136P probably damaging Het
Sox11 A G 12: 27,341,703 Y236H probably damaging Het
Tbc1d2 G A 4: 46,637,652 P198L possibly damaging Het
Tcof1 G T 18: 60,835,773 A256E probably damaging Het
Tenm4 A G 7: 96,906,290 Y2726C probably damaging Het
Tnfsf14 T A 17: 57,190,867 R122W probably damaging Het
Tril T C 6: 53,819,083 T385A probably damaging Het
Trrap A G 5: 144,825,874 T2386A probably benign Het
Tspear T A 10: 77,870,419 L341H possibly damaging Het
Uba7 A G 9: 107,979,288 M595V probably benign Het
Usp43 GC G 11: 67,855,740 probably null Het
Utrn C A 10: 12,436,364 D616Y probably damaging Het
Vmn2r69 T C 7: 85,410,196 I502V probably benign Het
Vps13d C A 4: 145,075,047 G419C probably damaging Het
Zbtb25 A T 12: 76,350,106 M114K probably benign Het
Zcchc4 A G 5: 52,796,132 Y161C probably damaging Het
Zfp292 A T 4: 34,808,593 F1484I possibly damaging Het
Zfp326 A G 5: 105,914,780 probably benign Het
Zfp395 T A 14: 65,393,116 S372T probably benign Het
Zfp423 T A 8: 87,781,178 E825V possibly damaging Het
Zfp445 A T 9: 122,852,240 Y879N probably benign Het
Zfp451 A G 1: 33,779,167 I77T possibly damaging Het
Zfp85 A T 13: 67,748,884 S356R probably benign Het
Other mutations in Plagl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Plagl1 APN 10 13127872 unclassified probably benign
R0554:Plagl1 UTSW 10 13127182 missense probably benign 0.07
R0842:Plagl1 UTSW 10 13128554 unclassified probably benign
R0967:Plagl1 UTSW 10 13128242 unclassified probably benign
R1610:Plagl1 UTSW 10 13128962 unclassified probably benign
R2002:Plagl1 UTSW 10 13128658 unclassified probably benign
R2107:Plagl1 UTSW 10 13128647 unclassified probably benign
R2191:Plagl1 UTSW 10 13128941 unclassified probably benign
R4061:Plagl1 UTSW 10 13128771 unclassified probably benign
R4062:Plagl1 UTSW 10 13128771 unclassified probably benign
R4631:Plagl1 UTSW 10 13127999 unclassified probably benign
R4924:Plagl1 UTSW 10 13127557 missense possibly damaging 0.85
R5071:Plagl1 UTSW 10 13127261 missense probably damaging 1.00
R5138:Plagl1 UTSW 10 13128175 unclassified probably benign
R5893:Plagl1 UTSW 10 13128194 unclassified probably benign
R5971:Plagl1 UTSW 10 13127746 missense probably damaging 1.00
R6061:Plagl1 UTSW 10 13127895 unclassified probably benign
R6138:Plagl1 UTSW 10 13127746 missense probably damaging 1.00
R6170:Plagl1 UTSW 10 13127231 missense probably damaging 1.00
R6625:Plagl1 UTSW 10 13128062 unclassified probably benign
R6970:Plagl1 UTSW 10 13125116 missense probably damaging 1.00
R7035:Plagl1 UTSW 10 13128233 unclassified probably benign
U15987:Plagl1 UTSW 10 13127746 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCCTACTCCCCAGAATGGC -3'
(R):5'- GATAGCAGTGTTGGAGCCAG -3'

Sequencing Primer
(F):5'- CCCCAGAATGGCTTTGTGAATAGC -3'
(R):5'- GCACTCACTGCTATTTGGGC -3'
Posted On2014-09-18