Mutagenetix > Incidental Mutation

Incidental Mutation 'R2108:Gprc6a'

232279

Institutional Source

Beutler Lab

Gene Symbol

Gprc6a

Ensembl Gene

ENSMUSG00000019905

Gene Name

G protein-coupled receptor, family C, group 6, member A

Synonyms

MMRRC Submission

040112-MU

Accession Numbers

Ncbi RefSeq: NM_153071.1; MGI:2429498

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2108 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

51614823-51631461 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 51615208 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 744 (V744E)

Ref Sequence

ENSEMBL: ENSMUSP00000151341 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020062] [ENSMUST00000218684] [ENSMUST00000219286]

AlphaFold

Q8K4Z6

Predicted Effect

probably damaging
Transcript: ENSMUST00000020062
AA Change: V815E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020062
Gene: ENSMUSG00000019905
AA Change: V815E

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:ANF_receptor	73	482	2.3e-62	PFAM
Pfam:NCD3G	519	572	5.9e-18	PFAM
Pfam:7tm_3	600	838	2e-49	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000218684
AA Change: V640E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000219286
AA Change: V744E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

Strain: 3831176
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of family C of the G protein-coupled receptor (GPCR) superfamily, such as GPRC6A, are characterized by an evolutionarily conserved amino acid-sensing motif linked to an intramembranous 7-transmembrane loop region. Several members of GPCR family C, including GPRC6A, also have a long N-terminal domain (summary by Pi et al., 2005 [PubMed 16199532]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show a metabolic syndrome characterized by impaired bone mineralization, increased fat mass, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance, testicular feminization and abnormal steroidogenesis. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd10	A	G	16: 45,731,940	M190T	probably benign	Het
Abhd5	A	G	9: 122,377,940	Y250C	probably damaging	Het
Ace2	A	G	X: 164,140,732	N24S	probably benign	Het
Adamtsl2	A	G	2: 27,095,558	M485V	probably benign	Het
Adamtsl4	G	T	3: 95,681,047	P577H	probably damaging	Het
Akap8l	C	T	17: 32,332,483	R511H	probably damaging	Het
Apc	T	C	18: 34,269,229	Y141H	probably damaging	Het
Arsi	A	T	18: 60,916,371	T109S	possibly damaging	Het
Asb3	G	A	11: 31,081,355		probably null	Het
Atm	T	C	9: 53,443,997	D2899G	probably damaging	Het
Bcas3	G	A	11: 85,457,878	V199I	probably damaging	Het
Bub1	T	C	2: 127,819,335	K279E	probably damaging	Het
C3	A	T	17: 57,223,974		probably null	Het
Cabcoco1	T	C	10: 68,431,323	K185E	probably benign	Het
Cadm2	A	T	16: 66,731,471	I326N	probably benign	Het
Ccr3	T	C	9: 124,029,299	S224P	possibly damaging	Het
Cdhr4	A	G	9: 107,997,644	T638A	probably damaging	Het
Cfap46	T	C	7: 139,683,761	I4V	probably benign	Het
Csf2rb2	A	T	15: 78,292,544	V216E	probably damaging	Het
Csmd3	A	T	15: 48,004,861	D754E	possibly damaging	Het
Dnaaf1	T	C	8: 119,582,732		probably null	Het
Dnah11	A	C	12: 118,020,353	Y2466D	probably damaging	Het
Dtx2	C	T	5: 136,030,577	S493F	probably damaging	Het
E2f7	T	C	10: 110,780,902	Y668H	probably benign	Het
Ehmt1	A	T	2: 24,837,618	S735T	probably damaging	Het
Eomes	T	C	9: 118,478,852	F65L	probably benign	Het
Ercc6l2	T	C	13: 63,871,988		probably benign	Het
Fbrsl1	A	T	5: 110,378,434	L439Q	probably damaging	Het
Fyco1	C	T	9: 123,797,516		probably null	Het
Gfm2	A	G	13: 97,155,442	T229A	probably benign	Het
Gm7735	G	A	16: 89,169,545	G19D	unknown	Het
Gm9745	G	A	13: 8,941,728	P221S	possibly damaging	Het
Gnpda1	T	C	18: 38,333,190		probably null	Het
Gpr6	T	A	10: 41,070,653	Y311F	possibly damaging	Het
Grin3a	C	T	4: 49,665,510	D1042N	possibly damaging	Het
Gstm3	A	G	3: 107,966,134	C174R	probably damaging	Het
Hectd4	A	G	5: 121,333,424	E2670G	possibly damaging	Het
Hsd3b6	A	T	3: 98,806,187	Y265*	probably null	Het
Hus1	T	A	11: 9,011,110	M1L	probably null	Het
Ifi213	T	G	1: 173,569,102		probably null	Het
Igf2r	A	C	17: 12,698,251	N1587K	probably benign	Het
Ints1	A	T	5: 139,767,750	V709E	probably damaging	Het
Ints8	C	A	4: 11,235,552	R359L	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lrp1b	C	T	2: 41,110,757	E2152K	probably damaging	Het
Lrp2	A	T	2: 69,506,624	V1268D	possibly damaging	Het
Mpo	T	C	11: 87,796,075	Y177H	probably damaging	Het
Mpp4	G	A	1: 59,143,782	P322L	possibly damaging	Het
Mprip	A	G	11: 59,769,891	K2166R	probably damaging	Het
Myo15	T	C	11: 60,491,810	Y1544H	probably damaging	Het
Neu1	G	A	17: 34,934,398	R299Q	probably benign	Het
Nfxl1	C	A	5: 72,514,332		probably null	Het
Nrp2	T	A	1: 62,744,277	I179N	probably damaging	Het
Nup153	A	G	13: 46,693,510		probably null	Het
Olfr130	G	T	17: 38,067,855	R228L	possibly damaging	Het
Olfr350	C	A	2: 36,850,343	A99E	possibly damaging	Het
Olfr474	A	T	7: 107,955,502	H287L	probably benign	Het
Olfr804	A	T	10: 129,705,621	I248L	probably benign	Het
Olfr944	A	T	9: 39,218,022	I222F	probably damaging	Het
P2ry12	A	T	3: 59,217,353	D300E	probably damaging	Het
Pkhd1	C	A	1: 20,553,574	G766*	probably null	Het
Plagl1	A	C	10: 13,128,647		probably benign	Het
Prkcq	A	T	2: 11,232,569	Y53F	probably damaging	Het
Psg18	T	C	7: 18,350,874	E99G	probably damaging	Het
Ptprz1	T	A	6: 23,033,477	H1921Q	probably damaging	Het
Rcc1l	A	G	5: 134,155,790	V391A	probably benign	Het
Sdr42e1	C	T	8: 117,665,024	V11I	probably damaging	Het
Slc12a3	C	A	8: 94,340,530	N404K	probably damaging	Het
Slc38a4	T	C	15: 97,008,997	M287V	probably benign	Het
Slc6a8	A	T	X: 73,676,886	I96F	possibly damaging	Het
Smyd2	A	G	1: 189,897,426	S136P	probably damaging	Het
Sox11	A	G	12: 27,341,703	Y236H	probably damaging	Het
Tbc1d2	G	A	4: 46,637,652	P198L	possibly damaging	Het
Tcof1	G	T	18: 60,835,773	A256E	probably damaging	Het
Tenm4	A	G	7: 96,906,290	Y2726C	probably damaging	Het
Tnfsf14	T	A	17: 57,190,867	R122W	probably damaging	Het
Tril	T	C	6: 53,819,083	T385A	probably damaging	Het
Trrap	A	G	5: 144,825,874	T2386A	probably benign	Het
Tspear	T	A	10: 77,870,419	L341H	possibly damaging	Het
Uba7	A	G	9: 107,979,288	M595V	probably benign	Het
Usp43	GC	G	11: 67,855,740		probably null	Het
Utrn	C	A	10: 12,436,364	D616Y	probably damaging	Het
Vmn2r69	T	C	7: 85,410,196	I502V	probably benign	Het
Vps13d	C	A	4: 145,075,047	G419C	probably damaging	Het
Zbtb25	A	T	12: 76,350,106	M114K	probably benign	Het
Zcchc4	A	G	5: 52,796,132	Y161C	probably damaging	Het
Zfp292	A	T	4: 34,808,593	F1484I	possibly damaging	Het
Zfp326	A	G	5: 105,914,780		probably benign	Het
Zfp395	T	A	14: 65,393,116	S372T	probably benign	Het
Zfp423	T	A	8: 87,781,178	E825V	possibly damaging	Het
Zfp445	A	T	9: 122,852,240	Y879N	probably benign	Het
Zfp451	A	G	1: 33,779,167	I77T	possibly damaging	Het
Zfp85	A	T	13: 67,748,884	S356R	probably benign	Het

Other mutations in Gprc6a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01361:Gprc6a	APN	10	51615430	missense	probably damaging	1.00
IGL01640:Gprc6a	APN	10	51627084	missense	probably damaging	0.99
IGL02122:Gprc6a	APN	10	51626723	missense	probably benign
IGL02317:Gprc6a	APN	10	51620953	missense	probably benign	0.01
IGL02995:Gprc6a	APN	10	51626799	missense	probably damaging	1.00
IGL03229:Gprc6a	APN	10	51616603	missense	probably damaging	1.00
IGL03256:Gprc6a	APN	10	51628349	missense	possibly damaging	0.77
IGL03290:Gprc6a	APN	10	51615872	missense	probably damaging	1.00
IGL03393:Gprc6a	APN	10	51615259	missense	probably damaging	1.00
R0040:Gprc6a	UTSW	10	51614984	nonsense	probably null
R0040:Gprc6a	UTSW	10	51614984	nonsense	probably null
R0050:Gprc6a	UTSW	10	51615389	missense	probably damaging	1.00
R0050:Gprc6a	UTSW	10	51615389	missense	probably damaging	1.00
R1495:Gprc6a	UTSW	10	51628437	missense	probably benign	0.01
R1831:Gprc6a	UTSW	10	51615806	missense	probably benign	0.22
R2159:Gprc6a	UTSW	10	51615680	frame shift	probably null
R2160:Gprc6a	UTSW	10	51615680	frame shift	probably null
R2162:Gprc6a	UTSW	10	51615680	frame shift	probably null
R2229:Gprc6a	UTSW	10	51626795	missense	possibly damaging	0.50
R3009:Gprc6a	UTSW	10	51628296	missense	probably benign	0.02
R3709:Gprc6a	UTSW	10	51615680	frame shift	probably null
R3710:Gprc6a	UTSW	10	51615680	frame shift	probably null
R3737:Gprc6a	UTSW	10	51626911	missense	probably benign
R3914:Gprc6a	UTSW	10	51628275	missense	probably benign	0.00
R3918:Gprc6a	UTSW	10	51615680	frame shift	probably null
R3964:Gprc6a	UTSW	10	51615680	frame shift	probably null
R3965:Gprc6a	UTSW	10	51615680	frame shift	probably null
R3966:Gprc6a	UTSW	10	51615680	frame shift	probably null
R3973:Gprc6a	UTSW	10	51628448	missense	possibly damaging	0.93
R3977:Gprc6a	UTSW	10	51621101	missense	probably benign	0.18
R3978:Gprc6a	UTSW	10	51621101	missense	probably benign	0.18
R3979:Gprc6a	UTSW	10	51621101	missense	probably benign	0.18
R4306:Gprc6a	UTSW	10	51616639	missense	probably damaging	1.00
R4404:Gprc6a	UTSW	10	51628543	missense	probably benign	0.09
R4405:Gprc6a	UTSW	10	51628543	missense	probably benign	0.09
R4408:Gprc6a	UTSW	10	51628543	missense	probably benign	0.09
R4713:Gprc6a	UTSW	10	51631457	unclassified	probably benign
R4788:Gprc6a	UTSW	10	51615008	missense	probably benign	0.00
R5248:Gprc6a	UTSW	10	51614993	missense	probably damaging	1.00
R5263:Gprc6a	UTSW	10	51626804	missense	probably damaging	1.00
R5436:Gprc6a	UTSW	10	51626702	missense	probably benign
R5721:Gprc6a	UTSW	10	51614980	missense	probably benign	0.06
R6061:Gprc6a	UTSW	10	51615811	missense	probably damaging	1.00
R6092:Gprc6a	UTSW	10	51615077	missense	probably damaging	1.00
R6132:Gprc6a	UTSW	10	51615260	missense	possibly damaging	0.89
R6162:Gprc6a	UTSW	10	51614912	missense	probably benign	0.44
R6207:Gprc6a	UTSW	10	51626835	missense	probably benign	0.36
R6497:Gprc6a	UTSW	10	51615701	missense	probably benign	0.05
R6717:Gprc6a	UTSW	10	51615137	missense	probably damaging	1.00
R6789:Gprc6a	UTSW	10	51631316	missense	probably damaging	1.00
R6807:Gprc6a	UTSW	10	51626745	nonsense	probably null
R7000:Gprc6a	UTSW	10	51615047	missense	probably benign	0.34
R7019:Gprc6a	UTSW	10	51631412	missense	possibly damaging	0.68
R7143:Gprc6a	UTSW	10	51614890	missense	probably benign
R7173:Gprc6a	UTSW	10	51628499	missense	probably benign	0.01
R7579:Gprc6a	UTSW	10	51626787	missense	probably benign
R7736:Gprc6a	UTSW	10	51615453	missense	possibly damaging	0.82
R7920:Gprc6a	UTSW	10	51614930	missense	probably benign	0.02
R8273:Gprc6a	UTSW	10	51631274	missense	probably benign
R8329:Gprc6a	UTSW	10	51627259	nonsense	probably null
R8517:Gprc6a	UTSW	10	51631241	missense	probably benign	0.00
R8723:Gprc6a	UTSW	10	51615422	missense	probably damaging	1.00
R8815:Gprc6a	UTSW	10	51620983	missense	probably benign	0.00
R8829:Gprc6a	UTSW	10	51615199	missense	probably damaging	0.99
R9151:Gprc6a	UTSW	10	51621086	missense	possibly damaging	0.94
R9420:Gprc6a	UTSW	10	51615410	missense	probably damaging	0.99
R9753:Gprc6a	UTSW	10	51628268	missense	probably benign	0.20
R9766:Gprc6a	UTSW	10	51615788	missense	probably damaging	1.00
R9790:Gprc6a	UTSW	10	51615299	missense	probably damaging	0.98
R9791:Gprc6a	UTSW	10	51615299	missense	probably damaging	0.98
Z1177:Gprc6a	UTSW	10	51615209	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GTTACCAGGGCTCTGATTGG -3'
(R):5'- GGGCTACATCACAGTTCTGG -3'

Sequencing Primer
(F):5'- CAGTATCGTAGCTGGTGGAGTCC -3'
(R):5'- ACATCACAGTTCTGGCCTTCATTTG -3'

Posted On

2014-09-18