Incidental Mutation 'R2108:Mprip'
ID232286
Institutional Source Beutler Lab
Gene Symbol Mprip
Ensembl Gene ENSMUSG00000005417
Gene Namemyosin phosphatase Rho interacting protein
Synonymsp116Rip, Rhoip3, RIP3, p116 Rho interacting protein
MMRRC Submission 040112-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.453) question?
Stock #R2108 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location59661305-59780860 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59769891 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 2166 (K2166R)
Ref Sequence ENSEMBL: ENSMUSP00000071081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066330] [ENSMUST00000072031] [ENSMUST00000108751] [ENSMUST00000116371] [ENSMUST00000133861]
Predicted Effect probably damaging
Transcript: ENSMUST00000066330
AA Change: K2166R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071081
Gene: ENSMUSG00000005417
AA Change: K2166R

DomainStartEndE-ValueType
PH 44 152 3.33e-10 SMART
low complexity region 179 190 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
Blast:PH 249 320 1e-10 BLAST
PH 351 448 3.76e-18 SMART
low complexity region 492 501 N/A INTRINSIC
low complexity region 536 555 N/A INTRINSIC
coiled coil region 636 671 N/A INTRINSIC
Blast:PAC 806 848 2e-10 BLAST
low complexity region 1005 1023 N/A INTRINSIC
low complexity region 1047 1059 N/A INTRINSIC
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1183 1200 N/A INTRINSIC
coiled coil region 1267 1300 N/A INTRINSIC
coiled coil region 1617 1642 N/A INTRINSIC
coiled coil region 1729 1779 N/A INTRINSIC
coiled coil region 1899 1936 N/A INTRINSIC
coiled coil region 1960 2110 N/A INTRINSIC
coiled coil region 2132 2206 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000072031
AA Change: K934R

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000071914
Gene: ENSMUSG00000005417
AA Change: K934R

DomainStartEndE-ValueType
PH 44 152 3.33e-10 SMART
low complexity region 179 190 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
Blast:PH 254 320 1e-10 BLAST
PH 387 484 3.76e-18 SMART
low complexity region 528 537 N/A INTRINSIC
low complexity region 572 591 N/A INTRINSIC
coiled coil region 672 707 N/A INTRINSIC
coiled coil region 728 878 N/A INTRINSIC
coiled coil region 900 974 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108751
AA Change: K896R

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104382
Gene: ENSMUSG00000005417
AA Change: K896R

DomainStartEndE-ValueType
PH 44 152 3.33e-10 SMART
low complexity region 183 196 N/A INTRINSIC
Blast:PH 216 282 1e-10 BLAST
PH 349 446 3.76e-18 SMART
low complexity region 490 499 N/A INTRINSIC
low complexity region 534 553 N/A INTRINSIC
coiled coil region 634 669 N/A INTRINSIC
coiled coil region 690 840 N/A INTRINSIC
coiled coil region 862 936 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000116371
AA Change: K934R

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112072
Gene: ENSMUSG00000005417
AA Change: K934R

DomainStartEndE-ValueType
PH 44 152 3.33e-10 SMART
low complexity region 179 190 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
Blast:PH 254 320 1e-10 BLAST
PH 387 484 3.76e-18 SMART
low complexity region 528 537 N/A INTRINSIC
low complexity region 572 591 N/A INTRINSIC
coiled coil region 672 707 N/A INTRINSIC
coiled coil region 728 878 N/A INTRINSIC
coiled coil region 900 974 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132620
AA Change: K744R

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000119422
Gene: ENSMUSG00000005417
AA Change: K744R

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
low complexity region 68 81 N/A INTRINSIC
Blast:PH 101 167 9e-11 BLAST
PH 198 295 3.76e-18 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 383 402 N/A INTRINSIC
coiled coil region 482 517 N/A INTRINSIC
coiled coil region 538 688 N/A INTRINSIC
coiled coil region 710 784 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000133861
AA Change: K920R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119562
Gene: ENSMUSG00000005417
AA Change: K920R

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
low complexity region 47 58 N/A INTRINSIC
low complexity region 89 102 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
PH 373 470 3.76e-18 SMART
low complexity region 514 523 N/A INTRINSIC
low complexity region 558 577 N/A INTRINSIC
coiled coil region 658 693 N/A INTRINSIC
coiled coil region 714 864 N/A INTRINSIC
coiled coil region 886 960 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000156111
AA Change: K407R

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114446
Gene: ENSMUSG00000005417
AA Change: K407R

DomainStartEndE-ValueType
internal_repeat_1 5 38 1.61e-7 PROSPERO
internal_repeat_2 9 51 2.4e-6 PROSPERO
internal_repeat_1 59 92 1.61e-7 PROSPERO
internal_repeat_2 85 129 2.4e-6 PROSPERO
coiled coil region 140 177 N/A INTRINSIC
coiled coil region 201 351 N/A INTRINSIC
coiled coil region 373 447 N/A INTRINSIC
Meta Mutation Damage Score 0.0732 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd10 A G 16: 45,731,940 M190T probably benign Het
Abhd5 A G 9: 122,377,940 Y250C probably damaging Het
Ace2 A G X: 164,140,732 N24S probably benign Het
Adamtsl2 A G 2: 27,095,558 M485V probably benign Het
Adamtsl4 G T 3: 95,681,047 P577H probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Apc T C 18: 34,269,229 Y141H probably damaging Het
Arsi A T 18: 60,916,371 T109S possibly damaging Het
Asb3 G A 11: 31,081,355 probably null Het
Atm T C 9: 53,443,997 D2899G probably damaging Het
Bcas3 G A 11: 85,457,878 V199I probably damaging Het
Bub1 T C 2: 127,819,335 K279E probably damaging Het
C3 A T 17: 57,223,974 probably null Het
Cabcoco1 T C 10: 68,431,323 K185E probably benign Het
Cadm2 A T 16: 66,731,471 I326N probably benign Het
Ccr3 T C 9: 124,029,299 S224P possibly damaging Het
Cdhr4 A G 9: 107,997,644 T638A probably damaging Het
Cfap46 T C 7: 139,683,761 I4V probably benign Het
Csf2rb2 A T 15: 78,292,544 V216E probably damaging Het
Csmd3 A T 15: 48,004,861 D754E possibly damaging Het
Dnaaf1 T C 8: 119,582,732 probably null Het
Dnah11 A C 12: 118,020,353 Y2466D probably damaging Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
E2f7 T C 10: 110,780,902 Y668H probably benign Het
Ehmt1 A T 2: 24,837,618 S735T probably damaging Het
Eomes T C 9: 118,478,852 F65L probably benign Het
Ercc6l2 T C 13: 63,871,988 probably benign Het
Fbrsl1 A T 5: 110,378,434 L439Q probably damaging Het
Fyco1 C T 9: 123,797,516 probably null Het
Gfm2 A G 13: 97,155,442 T229A probably benign Het
Gm7735 G A 16: 89,169,545 G19D unknown Het
Gm9745 G A 13: 8,941,728 P221S possibly damaging Het
Gnpda1 T C 18: 38,333,190 probably null Het
Gpr6 T A 10: 41,070,653 Y311F possibly damaging Het
Gprc6a A T 10: 51,615,208 V744E probably damaging Het
Grin3a C T 4: 49,665,510 D1042N possibly damaging Het
Gstm3 A G 3: 107,966,134 C174R probably damaging Het
Hectd4 A G 5: 121,333,424 E2670G possibly damaging Het
Hsd3b6 A T 3: 98,806,187 Y265* probably null Het
Hus1 T A 11: 9,011,110 M1L probably null Het
Ifi213 T G 1: 173,569,102 probably null Het
Igf2r A C 17: 12,698,251 N1587K probably benign Het
Ints1 A T 5: 139,767,750 V709E probably damaging Het
Ints8 C A 4: 11,235,552 R359L probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrp1b C T 2: 41,110,757 E2152K probably damaging Het
Lrp2 A T 2: 69,506,624 V1268D possibly damaging Het
Mpo T C 11: 87,796,075 Y177H probably damaging Het
Mpp4 G A 1: 59,143,782 P322L possibly damaging Het
Myo15 T C 11: 60,491,810 Y1544H probably damaging Het
Neu1 G A 17: 34,934,398 R299Q probably benign Het
Nfxl1 C A 5: 72,514,332 probably null Het
Nrp2 T A 1: 62,744,277 I179N probably damaging Het
Nup153 A G 13: 46,693,510 probably null Het
Olfr130 G T 17: 38,067,855 R228L possibly damaging Het
Olfr350 C A 2: 36,850,343 A99E possibly damaging Het
Olfr474 A T 7: 107,955,502 H287L probably benign Het
Olfr804 A T 10: 129,705,621 I248L probably benign Het
Olfr944 A T 9: 39,218,022 I222F probably damaging Het
P2ry12 A T 3: 59,217,353 D300E probably damaging Het
Pkhd1 C A 1: 20,553,574 G766* probably null Het
Plagl1 A C 10: 13,128,647 probably benign Het
Prkcq A T 2: 11,232,569 Y53F probably damaging Het
Psg18 T C 7: 18,350,874 E99G probably damaging Het
Ptprz1 T A 6: 23,033,477 H1921Q probably damaging Het
Rcc1l A G 5: 134,155,790 V391A probably benign Het
Sdr42e1 C T 8: 117,665,024 V11I probably damaging Het
Slc12a3 C A 8: 94,340,530 N404K probably damaging Het
Slc38a4 T C 15: 97,008,997 M287V probably benign Het
Slc6a8 A T X: 73,676,886 I96F possibly damaging Het
Smyd2 A G 1: 189,897,426 S136P probably damaging Het
Sox11 A G 12: 27,341,703 Y236H probably damaging Het
Tbc1d2 G A 4: 46,637,652 P198L possibly damaging Het
Tcof1 G T 18: 60,835,773 A256E probably damaging Het
Tenm4 A G 7: 96,906,290 Y2726C probably damaging Het
Tnfsf14 T A 17: 57,190,867 R122W probably damaging Het
Tril T C 6: 53,819,083 T385A probably damaging Het
Trrap A G 5: 144,825,874 T2386A probably benign Het
Tspear T A 10: 77,870,419 L341H possibly damaging Het
Uba7 A G 9: 107,979,288 M595V probably benign Het
Usp43 GC G 11: 67,855,740 probably null Het
Utrn C A 10: 12,436,364 D616Y probably damaging Het
Vmn2r69 T C 7: 85,410,196 I502V probably benign Het
Vps13d C A 4: 145,075,047 G419C probably damaging Het
Zbtb25 A T 12: 76,350,106 M114K probably benign Het
Zcchc4 A G 5: 52,796,132 Y161C probably damaging Het
Zfp292 A T 4: 34,808,593 F1484I possibly damaging Het
Zfp326 A G 5: 105,914,780 probably benign Het
Zfp395 T A 14: 65,393,116 S372T probably benign Het
Zfp423 T A 8: 87,781,178 E825V possibly damaging Het
Zfp445 A T 9: 122,852,240 Y879N probably benign Het
Zfp451 A G 1: 33,779,167 I77T possibly damaging Het
Zfp85 A T 13: 67,748,884 S356R probably benign Het
Other mutations in Mprip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Mprip APN 11 59748591 missense probably benign 0.07
IGL00563:Mprip APN 11 59752617 missense probably damaging 1.00
IGL00905:Mprip APN 11 59772168 missense possibly damaging 0.79
IGL00928:Mprip APN 11 59744752 missense probably damaging 1.00
IGL01161:Mprip APN 11 59731573 missense possibly damaging 0.93
IGL01991:Mprip APN 11 59755012 missense probably damaging 0.99
IGL02491:Mprip APN 11 59770031 missense probably benign 0.13
IGL03030:Mprip APN 11 59741115 splice site probably null
IGL03056:Mprip APN 11 59771692 missense probably damaging 1.00
IGL03293:Mprip APN 11 59696163 missense probably damaging 1.00
R0049:Mprip UTSW 11 59766745 missense probably damaging 0.99
R0097:Mprip UTSW 11 59758491 missense possibly damaging 0.90
R0097:Mprip UTSW 11 59758491 missense possibly damaging 0.90
R0147:Mprip UTSW 11 59737073 missense possibly damaging 0.68
R0319:Mprip UTSW 11 59697038 splice site probably benign
R0471:Mprip UTSW 11 59759735 missense probably damaging 1.00
R0539:Mprip UTSW 11 59741117 splice site probably benign
R0627:Mprip UTSW 11 59769972 missense probably damaging 1.00
R0864:Mprip UTSW 11 59758761 missense probably benign
R1218:Mprip UTSW 11 59743814 missense probably damaging 1.00
R1469:Mprip UTSW 11 59759190 missense probably damaging 1.00
R1469:Mprip UTSW 11 59759190 missense probably damaging 1.00
R1695:Mprip UTSW 11 59752531 missense probably damaging 0.99
R1698:Mprip UTSW 11 59760258 missense possibly damaging 0.75
R1802:Mprip UTSW 11 59755041 missense probably damaging 1.00
R1837:Mprip UTSW 11 59766745 missense probably damaging 0.99
R1862:Mprip UTSW 11 59758221 missense possibly damaging 0.90
R2094:Mprip UTSW 11 59749508 splice site probably benign
R2107:Mprip UTSW 11 59769891 missense probably damaging 1.00
R2510:Mprip UTSW 11 59749508 splice site probably benign
R3003:Mprip UTSW 11 59727555 missense possibly damaging 0.95
R3115:Mprip UTSW 11 59765403 splice site probably null
R3941:Mprip UTSW 11 59731502 splice site probably benign
R4347:Mprip UTSW 11 59759453 missense possibly damaging 0.86
R4603:Mprip UTSW 11 59731573 missense probably damaging 1.00
R4807:Mprip UTSW 11 59758020 missense probably benign 0.00
R5011:Mprip UTSW 11 59759895 missense possibly damaging 0.75
R5338:Mprip UTSW 11 59760573 missense probably damaging 1.00
R5549:Mprip UTSW 11 59760818 missense probably benign 0.00
R5569:Mprip UTSW 11 59760963 missense probably damaging 1.00
R5604:Mprip UTSW 11 59758467 missense probably benign
R5615:Mprip UTSW 11 59758487 missense probably benign 0.08
R5846:Mprip UTSW 11 59758554 missense probably damaging 1.00
R5970:Mprip UTSW 11 59757721 missense probably damaging 0.96
R6054:Mprip UTSW 11 59758425 missense probably benign
R6452:Mprip UTSW 11 59752783 missense probably damaging 1.00
R6457:Mprip UTSW 11 59758989 missense possibly damaging 0.69
R6544:Mprip UTSW 11 59757726 missense probably benign 0.15
R6750:Mprip UTSW 11 59696131 missense probably damaging 1.00
R6843:Mprip UTSW 11 59759728 missense possibly damaging 0.54
R6851:Mprip UTSW 11 59759015 missense probably damaging 0.99
R6867:Mprip UTSW 11 59749630 critical splice donor site probably null
R7002:Mprip UTSW 11 59761190 missense probably benign 0.22
R7023:Mprip UTSW 11 59737389 missense probably damaging 1.00
R7764:Mprip UTSW 11 59764416 missense probably damaging 0.99
R7765:Mprip UTSW 11 59758221 missense possibly damaging 0.90
R7828:Mprip UTSW 11 59737089 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCTGACTGACTTCCACAAGG -3'
(R):5'- GTGCCAAAACATCTTCACGAG -3'

Sequencing Primer
(F):5'- TCCACAAGGAACTGTTAGACAG -3'
(R):5'- TCTTCACGAGGAGCACCCAG -3'
Posted On2014-09-18