Mutagenetix > Incidental Mutation

Incidental Mutation 'R0193:Rasa3'

23229

Institutional Source

Beutler Lab

Gene Symbol

Rasa3

Ensembl Gene

ENSMUSG00000031453

Gene Name

RAS p21 protein activator 3

Synonyms

GAPIII, R-Ras gap, Ras GTPase-activating protein III, GAPIII activator 3, scat

MMRRC Submission

038452-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0193 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

13566948-13677603 bp(-) (GRCm38)

Type of Mutation

splice site (6 bp from exon)

DNA Base Change (assembly)

A to G at 13570233 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000112998 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000117551]

AlphaFold

Q60790

Predicted Effect

probably null
Transcript: ENSMUST00000117551

SMART Domains

Protein: ENSMUSP00000112998
Gene: ENSMUSG00000031453

Domain	Start	End	E-Value	Type
C2	13	111	2.29e-15	SMART
C2	146	262	1.03e-17	SMART
RasGAP	275	614	3.96e-166	SMART
PH	577	679	5.53e-16	SMART
BTK	679	715	9.16e-19	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137822

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 94.7%
20x: 85.3%

Validation Efficiency

95% (186/196)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds inositol 1,3,4,5-tetrakisphosphate and stimulates the GTPase activity of Ras p21. This protein functions as a negative regulator of the Ras signalling pathway. It is localized to the cell membrane via a pleckstrin homology (PH) domain in the C-terminal region. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation die at E12.5-13.5 of massive subcutaneous and intraparenchymal hemorrhage, probably due to underdeveloped adherens junctions between capillary endothelial cells. At E12.5, edema and severe hemorrhaging is frequently observed in the brain and/or rump. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330182L06Rik	A	T	5: 9,422,359	Q352L	probably damaging	Het
Adgrb1	T	C	15: 74,572,156	S96P	probably damaging	Het
Akr1c20	A	G	13: 4,511,293		probably benign	Het
Atp2a3	G	T	11: 72,972,220	V99L	possibly damaging	Het
Atp6v0a1	T	A	11: 101,048,482	I691N	possibly damaging	Het
Atp8b1	C	T	18: 64,561,636	R525Q	probably benign	Het
Aurkb	A	G	11: 69,048,544	D151G	probably damaging	Het
Bank1	A	T	3: 136,066,518		probably benign	Het
Bcl9l	T	C	9: 44,507,406	L847P	probably damaging	Het
Bscl2	T	A	19: 8,847,429	M292K	probably benign	Het
Cacna1c	C	T	6: 118,602,402		probably benign	Het
Cadps2	T	C	6: 23,599,440	K260R	probably benign	Het
Cc2d2a	T	C	5: 43,736,118	S1419P	probably damaging	Het
Ccdc180	G	A	4: 45,914,803	E145K	probably benign	Het
Ccdc58	T	C	16: 36,082,814	S59P	probably damaging	Het
Ccno	C	T	13: 112,988,884		probably benign	Het
Cd300a	A	G	11: 114,893,376	D70G	probably benign	Het
Cenpc1	T	C	5: 86,032,403	D670G	probably benign	Het
Cenpl	A	G	1: 161,085,988	I323V	probably damaging	Het
Cfap44	A	G	16: 44,449,210		probably null	Het
Cfap74	C	T	4: 155,426,115	R386C	probably benign	Het
Cic	T	A	7: 25,287,140	S1299T	probably damaging	Het
Cic	C	A	7: 25,287,141	S1299Y	probably damaging	Het
Clcnkb	T	C	4: 141,412,316	E125G	possibly damaging	Het
Clstn1	G	A	4: 149,634,796	V361M	probably damaging	Het
Coro7	G	A	16: 4,627,504		probably benign	Het
Dchs1	C	T	7: 105,764,983	R875H	probably benign	Het
Eif3j1	A	C	2: 122,052,027	M239L	probably benign	Het
Eif4g3	G	T	4: 138,146,376		probably benign	Het
Erbb4	T	C	1: 68,043,960		probably benign	Het
Erlin2	T	G	8: 27,031,764	V164G	possibly damaging	Het
Fbxo43	G	T	15: 36,161,883	Q393K	probably benign	Het
Fcgr4	A	T	1: 171,025,760	N178I	possibly damaging	Het
Grid2	A	G	6: 64,063,953	N293S	possibly damaging	Het
H2-M1	C	T	17: 36,671,332	V126I	probably benign	Het
Htr1f	T	A	16: 64,926,749	Y60F	probably damaging	Het
Ilf2	A	G	3: 90,481,339		probably null	Het
Impg2	A	T	16: 56,265,049	K931*	probably null	Het
Ints1	T	C	5: 139,751,730	E2176G	probably damaging	Het
Iqsec2	T	C	X: 152,223,403	V1319A	probably benign	Het
Iqsec3	G	T	6: 121,410,724	D685E	probably damaging	Het
Itgbl1	G	A	14: 123,846,546	V279I	probably benign	Het
Kdm4b	C	T	17: 56,393,952	A541V	probably benign	Het
Kif14	A	T	1: 136,468,438	T161S	probably benign	Het
Krt86	T	C	15: 101,479,363		probably benign	Het
Kyat1	C	T	2: 30,187,186		probably null	Het
Limch1	T	C	5: 67,027,539	W791R	probably damaging	Het
Map3k11	T	A	19: 5,695,846	M396K	probably damaging	Het
Mat2a	A	G	6: 72,436,195		probably null	Het
Mbnl2	A	G	14: 120,379,237	I88V	possibly damaging	Het
Mib2	T	C	4: 155,655,673	T708A	probably benign	Het
Mkks	T	C	2: 136,877,606		probably null	Het
Mtss1	T	C	15: 58,944,017	M565V	probably damaging	Het
Myoc	A	G	1: 162,649,035	N436S	probably damaging	Het
Myod1	T	A	7: 46,377,112	V147E	probably damaging	Het
Ngef	A	G	1: 87,509,334	L144P	probably benign	Het
Ngrn	C	T	7: 80,261,930	R92W	probably damaging	Het
Nup153	G	A	13: 46,709,654	T349I	probably benign	Het
Olfr1211	T	A	2: 88,930,283	I11L	probably benign	Het
Olfr600	G	T	7: 103,346,204	S241R	possibly damaging	Het
Pigl	A	G	11: 62,503,748	I135M	probably damaging	Het
Pitpnm3	A	G	11: 72,070,492		probably benign	Het
Pkhd1	A	T	1: 20,358,917	F2420I	probably damaging	Het
Polr2b	C	T	5: 77,320,076	T119M	probably damaging	Het
Prr29	A	G	11: 106,376,896	Y130C	probably damaging	Het
Rab11fip3	T	C	17: 25,990,999	I1048V	probably damaging	Het
Rab12	G	A	17: 66,500,362	T124I	probably damaging	Het
Rab44	A	G	17: 29,140,307	S490G	probably benign	Het
Rhbdl3	C	T	11: 80,353,574	S369L	possibly damaging	Het
Rimbp2	A	T	5: 128,788,356	S643T	probably benign	Het
Rin1	T	G	19: 5,052,652	S396R	probably damaging	Het
Rpusd3	C	T	6: 113,419,237	G28S	probably damaging	Het
Rtl9	T	A	X: 143,100,278	S229T	probably damaging	Het
Rufy1	G	T	11: 50,389,852	T701N	probably benign	Het
Scn4a	A	T	11: 106,320,538	L1551*	probably null	Het
Sec24b	T	C	3: 129,988,984	N1119S	probably null	Het
Serbp1	T	A	6: 67,272,884	*75R	probably null	Het
Setx	C	T	2: 29,179,673	P2497S	probably benign	Het
Slc26a11	A	T	11: 119,359,314	I132F	probably damaging	Het
Slc4a1	A	G	11: 102,352,684	V707A	possibly damaging	Het
Slfn1	A	G	11: 83,121,843	I262V	probably damaging	Het
Tmem168	T	A	6: 13,583,313	D523V	possibly damaging	Het
Traf7	G	T	17: 24,510,551	Q469K	probably benign	Het
Trdmt1	C	A	2: 13,544,617	V6F	probably damaging	Het
Tsacc	A	T	3: 88,287,088		probably benign	Het
Vmn2r5	A	G	3: 64,491,530	I589T	possibly damaging	Het
Vmn2r7	T	C	3: 64,691,039	D699G	probably damaging	Het
Vmn2r82	T	C	10: 79,381,295	V487A	probably damaging	Het
Zfp287	A	T	11: 62,715,029	S351T	probably benign	Het
Zfp651	T	C	9: 121,767,666	V696A	probably damaging	Het
Zfp654	T	C	16: 64,785,688	H176R	possibly damaging	Het

Other mutations in Rasa3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00423:Rasa3	APN	8	13595410	unclassified	probably benign
IGL02112:Rasa3	APN	8	13585042	splice site	probably benign
IGL02946:Rasa3	APN	8	13598280	missense	probably benign	0.33
IGL03085:Rasa3	APN	8	13585690	missense	probably benign	0.11
Box_canyon	UTSW	8	13584959	nonsense	probably null
Erasor	UTSW	8	13586873	critical splice donor site	probably null
koko_head	UTSW	8	13614605	missense	possibly damaging	0.70
Mount_ouray	UTSW	8	13631811	missense	possibly damaging	0.90
Poncha_pass	UTSW	8	13595373	missense	possibly damaging	0.46
Tabula	UTSW	8	13585029	missense	probably damaging	1.00
Ute	UTSW	8	13582381	splice site	probably benign
PIT4531001:Rasa3	UTSW	8	13605887	missense	probably benign	0.11
R0710:Rasa3	UTSW	8	13583830	missense	probably damaging	1.00
R0726:Rasa3	UTSW	8	13580118	splice site	probably benign
R1405:Rasa3	UTSW	8	13588027	missense	possibly damaging	0.83
R1405:Rasa3	UTSW	8	13588027	missense	possibly damaging	0.83
R1797:Rasa3	UTSW	8	13582372	missense	probably benign	0.44
R1828:Rasa3	UTSW	8	13585035	missense	probably benign	0.02
R1895:Rasa3	UTSW	8	13631768	splice site	probably benign
R2090:Rasa3	UTSW	8	13582381	splice site	probably benign
R2374:Rasa3	UTSW	8	13577411	missense	probably damaging	1.00
R2655:Rasa3	UTSW	8	13595373	missense	possibly damaging	0.46
R3703:Rasa3	UTSW	8	13588972	missense	probably benign
R3899:Rasa3	UTSW	8	13578635	missense	probably benign	0.21
R4230:Rasa3	UTSW	8	13570264	missense	possibly damaging	0.47
R4256:Rasa3	UTSW	8	13614532	critical splice donor site	probably null
R4281:Rasa3	UTSW	8	13588946	missense	probably benign	0.01
R4498:Rasa3	UTSW	8	13614587	missense	probably benign	0.01
R4558:Rasa3	UTSW	8	13598259	missense	probably damaging	0.96
R4559:Rasa3	UTSW	8	13598259	missense	probably damaging	0.96
R4647:Rasa3	UTSW	8	13588865	missense	probably null	0.00
R4702:Rasa3	UTSW	8	13570394	missense	probably benign	0.09
R4772:Rasa3	UTSW	8	13598289	missense	probably damaging	1.00
R4774:Rasa3	UTSW	8	13577501	missense	probably benign	0.07
R4807:Rasa3	UTSW	8	13614633	missense	probably damaging	1.00
R5008:Rasa3	UTSW	8	13584959	nonsense	probably null
R5043:Rasa3	UTSW	8	13570368	missense	possibly damaging	0.59
R5352:Rasa3	UTSW	8	13631778	missense	possibly damaging	0.88
R5435:Rasa3	UTSW	8	13631811	missense	possibly damaging	0.90
R6207:Rasa3	UTSW	8	13598251	missense	possibly damaging	0.67
R6733:Rasa3	UTSW	8	13580037	missense	possibly damaging	0.88
R6855:Rasa3	UTSW	8	13585029	missense	probably damaging	1.00
R7024:Rasa3	UTSW	8	13631826	missense	probably benign	0.29
R7100:Rasa3	UTSW	8	13586897	missense	probably benign	0.02
R7322:Rasa3	UTSW	8	13595857	missense	possibly damaging	0.46
R7394:Rasa3	UTSW	8	13595353	missense	probably benign	0.03
R7478:Rasa3	UTSW	8	13614605	missense	possibly damaging	0.70
R7486:Rasa3	UTSW	8	13590201	critical splice donor site	probably null
R7554:Rasa3	UTSW	8	13595390	missense	probably damaging	0.99
R7575:Rasa3	UTSW	8	13595887	missense	possibly damaging	0.73
R7641:Rasa3	UTSW	8	13584961	missense	probably benign	0.11
R7667:Rasa3	UTSW	8	13588015	missense	probably benign	0.27
R7751:Rasa3	UTSW	8	13568708	missense	probably benign	0.18
R7999:Rasa3	UTSW	8	13631805	missense	probably benign	0.04
R8039:Rasa3	UTSW	8	13588931	missense	probably damaging	1.00
R8125:Rasa3	UTSW	8	13577801	splice site	probably null
R8514:Rasa3	UTSW	8	13581322	missense	probably benign	0.02
R8726:Rasa3	UTSW	8	13576381	missense	probably benign	0.00
R8728:Rasa3	UTSW	8	13586873	critical splice donor site	probably null
R8790:Rasa3	UTSW	8	13677391	critical splice donor site	probably null
R9036:Rasa3	UTSW	8	13595851	missense	probably benign	0.06
R9483:Rasa3	UTSW	8	13580033	critical splice donor site	probably null
R9602:Rasa3	UTSW	8	13631844	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGGCTCCTTCTAAGGCCCTAAACTG -3'
(R):5'- AATCCTGAGCTACACCCCGTACTG -3'

Sequencing Primer
(F):5'- TAAGGCCCTAAACTGGGCTG -3'
(R):5'- GGCAGCAAGTCTGTGTATGAC -3'

Posted On

2013-04-16