Mutagenetix > Incidental Mutation

Incidental Mutation 'R2108:Igf2r'

232309

Institutional Source

Beutler Lab

Gene Symbol

Igf2r

Ensembl Gene

ENSMUSG00000023830

Gene Name

insulin-like growth factor 2 receptor

Synonyms

M6P/IGF2R, IGF-II/CI-MPR, Mpr300, CI-MPR, CD222, mannose-6-phosphate receptor, cation independent

MMRRC Submission

040112-MU

Accession Numbers

Genbank: NM_010515.2; Ensembl: ENSMUST00000024599, ENSMUST00000162982, ENSMUST00000159127

Is this an essential gene?

Probably essential (E-score: 0.925) question?

Stock #

R2108 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12682406-12769664 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 12698251 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 1587 (N1587K)

Ref Sequence

ENSEMBL: ENSMUSP00000024599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024599]

AlphaFold

Q07113

Predicted Effect

probably benign
Transcript: ENSMUST00000024599
AA Change: N1587K

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: N1587K

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
low complexity region	94	104	N/A	INTRINSIC
Pfam:CIMR	118	266	5.1e-21	PFAM
Pfam:CIMR	272	416	8.8e-22	PFAM
Pfam:CIMR	418	567	3.4e-53	PFAM
Pfam:CIMR	569	709	6.5e-47	PFAM
Pfam:CIMR	713	869	6.5e-34	PFAM
Pfam:CIMR	876	1020	1.9e-10	PFAM
Pfam:CIMR	1024	1171	1e-60	PFAM
Pfam:CIMR	1172	1313	1.2e-17	PFAM
Pfam:CIMR	1315	1455	2.1e-58	PFAM
Pfam:CIMR	1458	1592	1.8e-22	PFAM
Pfam:CIMR	1596	1743	9.1e-23	PFAM
Pfam:CIMR	1748	1887	2.5e-22	PFAM
FN2	1889	1935	9.51e-26	SMART
Pfam:CIMR	1939	2076	2.1e-22	PFAM
Pfam:CIMR	2230	2294	4.9e-9	PFAM
transmembrane domain	2295	2317	N/A	INTRINSIC
low complexity region	2336	2363	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161738

SMART Domains

Protein: ENSMUSP00000124664
Gene: ENSMUSG00000023830

Domain	Start	End	E-Value	Type
Pfam:CIMR	1	65	3.1e-24	PFAM
Pfam:CIMR	68	129	6.1e-15	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd10	A	G	16: 45,731,940	M190T	probably benign	Het
Abhd5	A	G	9: 122,377,940	Y250C	probably damaging	Het
Ace2	A	G	X: 164,140,732	N24S	probably benign	Het
Adamtsl2	A	G	2: 27,095,558	M485V	probably benign	Het
Adamtsl4	G	T	3: 95,681,047	P577H	probably damaging	Het
Akap8l	C	T	17: 32,332,483	R511H	probably damaging	Het
Apc	T	C	18: 34,269,229	Y141H	probably damaging	Het
Arsi	A	T	18: 60,916,371	T109S	possibly damaging	Het
Asb3	G	A	11: 31,081,355		probably null	Het
Atm	T	C	9: 53,443,997	D2899G	probably damaging	Het
Bcas3	G	A	11: 85,457,878	V199I	probably damaging	Het
Bub1	T	C	2: 127,819,335	K279E	probably damaging	Het
C3	A	T	17: 57,223,974		probably null	Het
Cabcoco1	T	C	10: 68,431,323	K185E	probably benign	Het
Cadm2	A	T	16: 66,731,471	I326N	probably benign	Het
Ccr3	T	C	9: 124,029,299	S224P	possibly damaging	Het
Cdhr4	A	G	9: 107,997,644	T638A	probably damaging	Het
Cfap46	T	C	7: 139,683,761	I4V	probably benign	Het
Csf2rb2	A	T	15: 78,292,544	V216E	probably damaging	Het
Csmd3	A	T	15: 48,004,861	D754E	possibly damaging	Het
Dnaaf1	T	C	8: 119,582,732		probably null	Het
Dnah11	A	C	12: 118,020,353	Y2466D	probably damaging	Het
Dtx2	C	T	5: 136,030,577	S493F	probably damaging	Het
E2f7	T	C	10: 110,780,902	Y668H	probably benign	Het
Ehmt1	A	T	2: 24,837,618	S735T	probably damaging	Het
Eomes	T	C	9: 118,478,852	F65L	probably benign	Het
Ercc6l2	T	C	13: 63,871,988		probably benign	Het
Fbrsl1	A	T	5: 110,378,434	L439Q	probably damaging	Het
Fyco1	C	T	9: 123,797,516		probably null	Het
Gfm2	A	G	13: 97,155,442	T229A	probably benign	Het
Gm7735	G	A	16: 89,169,545	G19D	unknown	Het
Gm9745	G	A	13: 8,941,728	P221S	possibly damaging	Het
Gnpda1	T	C	18: 38,333,190		probably null	Het
Gpr6	T	A	10: 41,070,653	Y311F	possibly damaging	Het
Gprc6a	A	T	10: 51,615,208	V744E	probably damaging	Het
Grin3a	C	T	4: 49,665,510	D1042N	possibly damaging	Het
Gstm3	A	G	3: 107,966,134	C174R	probably damaging	Het
Hectd4	A	G	5: 121,333,424	E2670G	possibly damaging	Het
Hsd3b6	A	T	3: 98,806,187	Y265*	probably null	Het
Hus1	T	A	11: 9,011,110	M1L	probably null	Het
Ifi213	T	G	1: 173,569,102		probably null	Het
Ints1	A	T	5: 139,767,750	V709E	probably damaging	Het
Ints8	C	A	4: 11,235,552	R359L	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lrp1b	C	T	2: 41,110,757	E2152K	probably damaging	Het
Lrp2	A	T	2: 69,506,624	V1268D	possibly damaging	Het
Mpo	T	C	11: 87,796,075	Y177H	probably damaging	Het
Mpp4	G	A	1: 59,143,782	P322L	possibly damaging	Het
Mprip	A	G	11: 59,769,891	K2166R	probably damaging	Het
Myo15	T	C	11: 60,491,810	Y1544H	probably damaging	Het
Neu1	G	A	17: 34,934,398	R299Q	probably benign	Het
Nfxl1	C	A	5: 72,514,332		probably null	Het
Nrp2	T	A	1: 62,744,277	I179N	probably damaging	Het
Nup153	A	G	13: 46,693,510		probably null	Het
Olfr130	G	T	17: 38,067,855	R228L	possibly damaging	Het
Olfr350	C	A	2: 36,850,343	A99E	possibly damaging	Het
Olfr474	A	T	7: 107,955,502	H287L	probably benign	Het
Olfr804	A	T	10: 129,705,621	I248L	probably benign	Het
Olfr944	A	T	9: 39,218,022	I222F	probably damaging	Het
P2ry12	A	T	3: 59,217,353	D300E	probably damaging	Het
Pkhd1	C	A	1: 20,553,574	G766*	probably null	Het
Plagl1	A	C	10: 13,128,647		probably benign	Het
Prkcq	A	T	2: 11,232,569	Y53F	probably damaging	Het
Psg18	T	C	7: 18,350,874	E99G	probably damaging	Het
Ptprz1	T	A	6: 23,033,477	H1921Q	probably damaging	Het
Rcc1l	A	G	5: 134,155,790	V391A	probably benign	Het
Sdr42e1	C	T	8: 117,665,024	V11I	probably damaging	Het
Slc12a3	C	A	8: 94,340,530	N404K	probably damaging	Het
Slc38a4	T	C	15: 97,008,997	M287V	probably benign	Het
Slc6a8	A	T	X: 73,676,886	I96F	possibly damaging	Het
Smyd2	A	G	1: 189,897,426	S136P	probably damaging	Het
Sox11	A	G	12: 27,341,703	Y236H	probably damaging	Het
Tbc1d2	G	A	4: 46,637,652	P198L	possibly damaging	Het
Tcof1	G	T	18: 60,835,773	A256E	probably damaging	Het
Tenm4	A	G	7: 96,906,290	Y2726C	probably damaging	Het
Tnfsf14	T	A	17: 57,190,867	R122W	probably damaging	Het
Tril	T	C	6: 53,819,083	T385A	probably damaging	Het
Trrap	A	G	5: 144,825,874	T2386A	probably benign	Het
Tspear	T	A	10: 77,870,419	L341H	possibly damaging	Het
Uba7	A	G	9: 107,979,288	M595V	probably benign	Het
Usp43	GC	G	11: 67,855,740		probably null	Het
Utrn	C	A	10: 12,436,364	D616Y	probably damaging	Het
Vmn2r69	T	C	7: 85,410,196	I502V	probably benign	Het
Vps13d	C	A	4: 145,075,047	G419C	probably damaging	Het
Zbtb25	A	T	12: 76,350,106	M114K	probably benign	Het
Zcchc4	A	G	5: 52,796,132	Y161C	probably damaging	Het
Zfp292	A	T	4: 34,808,593	F1484I	possibly damaging	Het
Zfp326	A	G	5: 105,914,780		probably benign	Het
Zfp395	T	A	14: 65,393,116	S372T	probably benign	Het
Zfp423	T	A	8: 87,781,178	E825V	possibly damaging	Het
Zfp445	A	T	9: 122,852,240	Y879N	probably benign	Het
Zfp451	A	G	1: 33,779,167	I77T	possibly damaging	Het
Zfp85	A	T	13: 67,748,884	S356R	probably benign	Het

Other mutations in Igf2r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Igf2r	APN	17	12713990	missense	probably benign	0.01
IGL00534:Igf2r	APN	17	12739328	missense	probably damaging	0.97
IGL00902:Igf2r	APN	17	12700358	missense	probably damaging	0.99
IGL00903:Igf2r	APN	17	12683867	missense	possibly damaging	0.70
IGL01160:Igf2r	APN	17	12704775	missense	possibly damaging	0.73
IGL01380:Igf2r	APN	17	12695374	missense	probably benign	0.01
IGL01392:Igf2r	APN	17	12704349	missense	probably benign
IGL01557:Igf2r	APN	17	12704635	missense	possibly damaging	0.82
IGL01568:Igf2r	APN	17	12683985	missense	possibly damaging	0.93
IGL01611:Igf2r	APN	17	12725415	nonsense	probably null
IGL01720:Igf2r	APN	17	12701313	missense	probably damaging	0.99
IGL01756:Igf2r	APN	17	12683822	missense	probably benign
IGL01839:Igf2r	APN	17	12705022	missense	probably damaging	1.00
IGL01904:Igf2r	APN	17	12714911	missense	probably damaging	0.99
IGL01965:Igf2r	APN	17	12704338	missense	probably benign	0.12
IGL02083:Igf2r	APN	17	12693192	nonsense	probably null
IGL02095:Igf2r	APN	17	12702005	missense	probably damaging	0.99
IGL02183:Igf2r	APN	17	12698516	unclassified	probably benign
IGL02576:Igf2r	APN	17	12748763	missense	possibly damaging	0.90
IGL02649:Igf2r	APN	17	12712087	missense	possibly damaging	0.93
IGL02807:Igf2r	APN	17	12719883	missense	probably damaging	0.98
IGL02833:Igf2r	APN	17	12692723	missense	probably damaging	0.97
IGL02885:Igf2r	APN	17	12694120	missense	possibly damaging	0.94
IGL02990:Igf2r	APN	17	12710746	splice site	probably benign
IGL03080:Igf2r	APN	17	12726676	missense	probably benign	0.06
IGL03176:Igf2r	APN	17	12716672	missense	probably damaging	1.00
outlier	UTSW	17	12695314	missense	probably benign	0.20
NA:Igf2r	UTSW	17	12691962	missense	probably benign
R0165:Igf2r	UTSW	17	12698527	missense	probably benign	0.07
R0412:Igf2r	UTSW	17	12683948	missense	probably damaging	0.98
R0523:Igf2r	UTSW	17	12692064	missense	probably benign	0.27
R0631:Igf2r	UTSW	17	12717274	splice site	probably null
R0722:Igf2r	UTSW	17	12715495	critical splice acceptor site	probably null
R0894:Igf2r	UTSW	17	12692101	missense	probably benign	0.02
R1265:Igf2r	UTSW	17	12694124	missense	probably damaging	0.98
R1466:Igf2r	UTSW	17	12717269	splice site	probably benign
R1485:Igf2r	UTSW	17	12691285	missense	probably damaging	1.00
R1633:Igf2r	UTSW	17	12726309	missense	probably benign
R1693:Igf2r	UTSW	17	12704316	missense	probably damaging	0.97
R1751:Igf2r	UTSW	17	12697441	missense	possibly damaging	0.94
R1843:Igf2r	UTSW	17	12704270	critical splice donor site	probably null
R1981:Igf2r	UTSW	17	12733903	nonsense	probably null
R1994:Igf2r	UTSW	17	12692738	missense	probably benign
R2060:Igf2r	UTSW	17	12701319	missense	possibly damaging	0.92
R2132:Igf2r	UTSW	17	12722208	missense	probably benign	0.12
R2314:Igf2r	UTSW	17	12715943	missense	probably benign	0.28
R2349:Igf2r	UTSW	17	12722311	splice site	probably null
R2696:Igf2r	UTSW	17	12695344	missense	possibly damaging	0.96
R2864:Igf2r	UTSW	17	12686724	missense	probably damaging	0.99
R2865:Igf2r	UTSW	17	12686724	missense	probably damaging	0.99
R3884:Igf2r	UTSW	17	12709468	missense	probably benign
R3930:Igf2r	UTSW	17	12705829	missense	probably benign	0.01
R4021:Igf2r	UTSW	17	12748751	missense	probably damaging	0.97
R4125:Igf2r	UTSW	17	12702254	missense	possibly damaging	0.93
R4342:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4343:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4345:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4760:Igf2r	UTSW	17	12703465	missense	possibly damaging	0.92
R4796:Igf2r	UTSW	17	12684126	missense	possibly damaging	0.70
R4816:Igf2r	UTSW	17	12684097	missense	probably damaging	0.96
R4826:Igf2r	UTSW	17	12701353	missense	probably damaging	0.98
R4933:Igf2r	UTSW	17	12691877	splice site	probably null
R4980:Igf2r	UTSW	17	12703360	critical splice donor site	probably null
R5389:Igf2r	UTSW	17	12725416	missense	probably damaging	1.00
R5473:Igf2r	UTSW	17	12695314	missense	probably benign	0.20
R5494:Igf2r	UTSW	17	12693145	missense	possibly damaging	0.74
R5619:Igf2r	UTSW	17	12739334	missense	probably damaging	1.00
R5738:Igf2r	UTSW	17	12717367	missense	probably benign	0.23
R5761:Igf2r	UTSW	17	12698352	splice site	probably null
R5794:Igf2r	UTSW	17	12709445	missense	probably benign	0.37
R6210:Igf2r	UTSW	17	12714951	missense	probably damaging	0.98
R6319:Igf2r	UTSW	17	12714113	missense	probably damaging	1.00
R6388:Igf2r	UTSW	17	12683900	missense	probably benign
R6396:Igf2r	UTSW	17	12714090	missense	probably benign	0.00
R6584:Igf2r	UTSW	17	12701250	missense	probably damaging	0.99
R6590:Igf2r	UTSW	17	12691937	nonsense	probably null
R6591:Igf2r	UTSW	17	12689008	missense	probably damaging	1.00
R6599:Igf2r	UTSW	17	12698618	missense	possibly damaging	0.85
R6690:Igf2r	UTSW	17	12691937	nonsense	probably null
R6691:Igf2r	UTSW	17	12689008	missense	probably damaging	1.00
R6752:Igf2r	UTSW	17	12714944	missense	probably damaging	1.00
R6816:Igf2r	UTSW	17	12714082	missense	probably damaging	0.99
R6841:Igf2r	UTSW	17	12703376	missense	probably damaging	0.97
R6877:Igf2r	UTSW	17	12697341	missense	probably damaging	0.97
R6950:Igf2r	UTSW	17	12718718	missense	probably benign
R7030:Igf2r	UTSW	17	12733866	missense	probably damaging	1.00
R7038:Igf2r	UTSW	17	12698325	missense	probably benign	0.23
R7055:Igf2r	UTSW	17	12704323	missense	probably damaging	0.99
R7074:Igf2r	UTSW	17	12714116	missense	possibly damaging	0.57
R7348:Igf2r	UTSW	17	12703484	missense	probably damaging	0.99
R7413:Igf2r	UTSW	17	12698228	nonsense	probably null
R7463:Igf2r	UTSW	17	12710645	missense	probably benign	0.16
R7619:Igf2r	UTSW	17	12698273	missense	possibly damaging	0.88
R7730:Igf2r	UTSW	17	12735991	missense	probably damaging	0.98
R7733:Igf2r	UTSW	17	12739369	missense	possibly damaging	0.90
R7881:Igf2r	UTSW	17	12748704	missense	probably benign
R8022:Igf2r	UTSW	17	12718795	missense	probably damaging	1.00
R8138:Igf2r	UTSW	17	12701238	missense	probably benign	0.32
R8220:Igf2r	UTSW	17	12692071	missense	probably benign	0.22
R8305:Igf2r	UTSW	17	12733860	missense	probably benign
R8359:Igf2r	UTSW	17	12683861	missense	probably benign
R8500:Igf2r	UTSW	17	12709441	missense	probably damaging	0.99
R8510:Igf2r	UTSW	17	12704313	missense	probably benign	0.38
R8933:Igf2r	UTSW	17	12701244	missense	probably damaging	0.97
R8933:Igf2r	UTSW	17	12704637	missense	probably damaging	1.00
R8976:Igf2r	UTSW	17	12726772	missense	probably damaging	1.00
R8994:Igf2r	UTSW	17	12716650	missense	possibly damaging	0.87
R9059:Igf2r	UTSW	17	12751293	start codon destroyed	probably null
R9097:Igf2r	UTSW	17	12691213	missense	probably damaging	1.00
R9127:Igf2r	UTSW	17	12739351	missense	probably damaging	0.98
R9278:Igf2r	UTSW	17	12695353	missense	probably damaging	1.00
R9362:Igf2r	UTSW	17	12722175	missense	probably benign	0.02
R9371:Igf2r	UTSW	17	12705759	missense	possibly damaging	0.93
R9522:Igf2r	UTSW	17	12698328	missense	probably benign	0.26
X0028:Igf2r	UTSW	17	12704913	nonsense	probably null
Z1177:Igf2r	UTSW	17	12697399	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGCCTTGGACTGCTAGGAAC -3'
(R):5'- AGACACTGCGTTCTTCTGTG -3'

Sequencing Primer
(F):5'- TGCTAGGAACCAGCAAACTG -3'
(R):5'- CACTGCGTTCTTCTGTGAAATTAATC -3'

Posted On

2014-09-18