Incidental Mutation 'R2108:Tnfsf14'
ID232313
Institutional Source Beutler Lab
Gene Symbol Tnfsf14
Ensembl Gene ENSMUSG00000005824
Gene Nametumor necrosis factor (ligand) superfamily, member 14
SynonymsLIGHT, HVEM-L
MMRRC Submission 040112-MU
Accession Numbers

Ncbi RefSeq: 019418.2; MGI: 1355317

Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R2108 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location57189492-57194189 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57190867 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 122 (R122W)
Ref Sequence ENSEMBL: ENSMUSP00000005976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005976]
Predicted Effect probably damaging
Transcript: ENSMUST00000005976
AA Change: R122W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000005976
Gene: ENSMUSG00000005824
AA Change: R122W

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
TNF 92 239 1.22e-49 SMART
Meta Mutation Damage Score 0.3564 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype Strain: 2668383; 2671122; 2180198
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tumor necrosis factor (TNF) ligand family. This protein is a ligand for TNFRSF14, which is a member of the tumor necrosis factor receptor superfamily, and which is also known as a herpesvirus entry mediator (HVEM). This protein may function as a costimulatory factor for the activation of lymphoid cells and as a deterrent to infection by herpesvirus. This protein has been shown to stimulate the proliferation of T cells, and trigger apoptosis of various tumor cells. This protein is also reported to prevent tumor necrosis factor alpha mediated apoptosis in primary hepatocyte. Two alternatively spliced transcript variant encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene leads to selective impairment of CD8+ T cell function. Mice homozygous for a knock-out allele exhibit defects in CD8+ T cell-mediated allogenic responses. Mice homozygous for a different knock-out allele show increased resistance to experimentally-induced hepatitis. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(7)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd10 A G 16: 45,731,940 M190T probably benign Het
Abhd5 A G 9: 122,377,940 Y250C probably damaging Het
Ace2 A G X: 164,140,732 N24S probably benign Het
Adamtsl2 A G 2: 27,095,558 M485V probably benign Het
Adamtsl4 G T 3: 95,681,047 P577H probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Apc T C 18: 34,269,229 Y141H probably damaging Het
Arsi A T 18: 60,916,371 T109S possibly damaging Het
Asb3 G A 11: 31,081,355 probably null Het
Atm T C 9: 53,443,997 D2899G probably damaging Het
Bcas3 G A 11: 85,457,878 V199I probably damaging Het
Bub1 T C 2: 127,819,335 K279E probably damaging Het
C3 A T 17: 57,223,974 probably null Het
Cabcoco1 T C 10: 68,431,323 K185E probably benign Het
Cadm2 A T 16: 66,731,471 I326N probably benign Het
Ccr3 T C 9: 124,029,299 S224P possibly damaging Het
Cdhr4 A G 9: 107,997,644 T638A probably damaging Het
Cfap46 T C 7: 139,683,761 I4V probably benign Het
Csf2rb2 A T 15: 78,292,544 V216E probably damaging Het
Csmd3 A T 15: 48,004,861 D754E possibly damaging Het
Dnaaf1 T C 8: 119,582,732 probably null Het
Dnah11 A C 12: 118,020,353 Y2466D probably damaging Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
E2f7 T C 10: 110,780,902 Y668H probably benign Het
Ehmt1 A T 2: 24,837,618 S735T probably damaging Het
Eomes T C 9: 118,478,852 F65L probably benign Het
Ercc6l2 T C 13: 63,871,988 probably benign Het
Fbrsl1 A T 5: 110,378,434 L439Q probably damaging Het
Fyco1 C T 9: 123,797,516 probably null Het
Gfm2 A G 13: 97,155,442 T229A probably benign Het
Gm7735 G A 16: 89,169,545 G19D unknown Het
Gm9745 G A 13: 8,941,728 P221S possibly damaging Het
Gnpda1 T C 18: 38,333,190 probably null Het
Gpr6 T A 10: 41,070,653 Y311F possibly damaging Het
Gprc6a A T 10: 51,615,208 V744E probably damaging Het
Grin3a C T 4: 49,665,510 D1042N possibly damaging Het
Gstm3 A G 3: 107,966,134 C174R probably damaging Het
Hectd4 A G 5: 121,333,424 E2670G possibly damaging Het
Hsd3b6 A T 3: 98,806,187 Y265* probably null Het
Hus1 T A 11: 9,011,110 M1L probably null Het
Ifi213 T G 1: 173,569,102 probably null Het
Igf2r A C 17: 12,698,251 N1587K probably benign Het
Ints1 A T 5: 139,767,750 V709E probably damaging Het
Ints8 C A 4: 11,235,552 R359L probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrp1b C T 2: 41,110,757 E2152K probably damaging Het
Lrp2 A T 2: 69,506,624 V1268D possibly damaging Het
Mpo T C 11: 87,796,075 Y177H probably damaging Het
Mpp4 G A 1: 59,143,782 P322L possibly damaging Het
Mprip A G 11: 59,769,891 K2166R probably damaging Het
Myo15 T C 11: 60,491,810 Y1544H probably damaging Het
Neu1 G A 17: 34,934,398 R299Q probably benign Het
Nfxl1 C A 5: 72,514,332 probably null Het
Nrp2 T A 1: 62,744,277 I179N probably damaging Het
Nup153 A G 13: 46,693,510 probably null Het
Olfr130 G T 17: 38,067,855 R228L possibly damaging Het
Olfr350 C A 2: 36,850,343 A99E possibly damaging Het
Olfr474 A T 7: 107,955,502 H287L probably benign Het
Olfr804 A T 10: 129,705,621 I248L probably benign Het
Olfr944 A T 9: 39,218,022 I222F probably damaging Het
P2ry12 A T 3: 59,217,353 D300E probably damaging Het
Pkhd1 C A 1: 20,553,574 G766* probably null Het
Plagl1 A C 10: 13,128,647 probably benign Het
Prkcq A T 2: 11,232,569 Y53F probably damaging Het
Psg18 T C 7: 18,350,874 E99G probably damaging Het
Ptprz1 T A 6: 23,033,477 H1921Q probably damaging Het
Rcc1l A G 5: 134,155,790 V391A probably benign Het
Sdr42e1 C T 8: 117,665,024 V11I probably damaging Het
Slc12a3 C A 8: 94,340,530 N404K probably damaging Het
Slc38a4 T C 15: 97,008,997 M287V probably benign Het
Slc6a8 A T X: 73,676,886 I96F possibly damaging Het
Smyd2 A G 1: 189,897,426 S136P probably damaging Het
Sox11 A G 12: 27,341,703 Y236H probably damaging Het
Tbc1d2 G A 4: 46,637,652 P198L possibly damaging Het
Tcof1 G T 18: 60,835,773 A256E probably damaging Het
Tenm4 A G 7: 96,906,290 Y2726C probably damaging Het
Tril T C 6: 53,819,083 T385A probably damaging Het
Trrap A G 5: 144,825,874 T2386A probably benign Het
Tspear T A 10: 77,870,419 L341H possibly damaging Het
Uba7 A G 9: 107,979,288 M595V probably benign Het
Usp43 GC G 11: 67,855,740 probably null Het
Utrn C A 10: 12,436,364 D616Y probably damaging Het
Vmn2r69 T C 7: 85,410,196 I502V probably benign Het
Vps13d C A 4: 145,075,047 G419C probably damaging Het
Zbtb25 A T 12: 76,350,106 M114K probably benign Het
Zcchc4 A G 5: 52,796,132 Y161C probably damaging Het
Zfp292 A T 4: 34,808,593 F1484I possibly damaging Het
Zfp326 A G 5: 105,914,780 probably benign Het
Zfp395 T A 14: 65,393,116 S372T probably benign Het
Zfp423 T A 8: 87,781,178 E825V possibly damaging Het
Zfp445 A T 9: 122,852,240 Y879N probably benign Het
Zfp451 A G 1: 33,779,167 I77T possibly damaging Het
Zfp85 A T 13: 67,748,884 S356R probably benign Het
Other mutations in Tnfsf14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00676:Tnfsf14 APN 17 57192562 missense possibly damaging 0.89
IGL00962:Tnfsf14 APN 17 57192906 nonsense probably null
IGL02515:Tnfsf14 APN 17 57192600 missense probably benign
P0015:Tnfsf14 UTSW 17 57190815 missense probably damaging 1.00
R1435:Tnfsf14 UTSW 17 57190605 missense possibly damaging 0.60
R1566:Tnfsf14 UTSW 17 57193876 missense probably benign
R1791:Tnfsf14 UTSW 17 57190867 missense probably damaging 1.00
R1967:Tnfsf14 UTSW 17 57190807 missense probably damaging 1.00
R2202:Tnfsf14 UTSW 17 57190638 missense possibly damaging 0.67
R2203:Tnfsf14 UTSW 17 57190638 missense possibly damaging 0.67
R2204:Tnfsf14 UTSW 17 57190638 missense possibly damaging 0.67
R2205:Tnfsf14 UTSW 17 57190638 missense possibly damaging 0.67
R2232:Tnfsf14 UTSW 17 57193876 missense probably benign
R4790:Tnfsf14 UTSW 17 57190740 missense probably damaging 1.00
R5434:Tnfsf14 UTSW 17 57192592 missense probably benign 0.00
R7474:Tnfsf14 UTSW 17 57190848 missense
R7691:Tnfsf14 UTSW 17 57194024 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CCAGCAGTTCTAACTCCTTCGG -3'
(R):5'- CCCCTGCAAGATAGGAATGG -3'

Sequencing Primer
(F):5'- AGTTCTAACTCCTTCGGGTAGCG -3'
(R):5'- CAGCCTACTATGGTGGTGAAACC -3'
Posted On2014-09-18